-
Viral Prep#139505-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-Ef1a-DIO-PPO-Venus (#139505). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO-PPO-Venus plasmid DNA. EF1a-driven, Cre-dependent expression of Venus-tagged parapinopsin for spatiotemporal control of inhibitory GPCR signaling cascades. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsVenus (Cre-dependent)Available sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-Ef1a-DIO-PPO-Venus (AAV8)
Viral Prep#139505-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-DIO-PPO-Venus (#139505). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO-PPO-Venus plasmid DNA. EF1a-driven, Cre-dependent expression of Venus-tagged parapinopsin for spatiotemporal control of inhibitory GPCR signaling cascades. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsVenus (Cre-dependent)Available sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-PPO-Venus (AAV5)
Viral Prep#139504-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CAG-DIO-PPO-Venus (#139504). In addition to the viral particles, you will also receive purified pAAV-CAG-DIO-PPO-Venus plasmid DNA. CAG-driven, Cre-dependent expression of Venus-tagged parapinopsin. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsVenusAvailable sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
BW-Para
Bacterial Strain#172602PurposeThe BW-Para E. coli strain is used to screen the functions of chimeric AraC/XylS transcription activators using beta-galactosidase assays.DepositorBacterial ResistanceNoneAvailable sinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-eYFP (AAV9)
Viral Prep#117382-AAV9PurposeReady-to-use AAV9 particles produced from hSyn1-eYFP (#117382). In addition to the viral particles, you will also receive purified hSyn1-eYFP plasmid DNA. hSyn-driven eYFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagseYFPAvailable sinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-eYFP (AAV5)
Viral Prep#117382-AAV5PurposeReady-to-use AAV5 particles produced from hSyn1-eYFP (#117382). In addition to the viral particles, you will also receive purified hSyn1-eYFP plasmid DNA. hSyn-driven eYFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagseYFPAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-eYFP (AAV2)
Viral Prep#117382-AAV2PurposeReady-to-use AAV2 particles produced from hSyn1-eYFP (#117382). In addition to the viral particles, you will also receive purified hSyn1-eYFP plasmid DNA. hSyn-driven eYFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagseYFPAvailable sinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP (AAV2)
Viral Prep#104055-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-CAG-eYFP (#104055). In addition to the viral particles, you will also receive purified pAAV-CAG-eYFP plasmid DNA. CAG-driven eYFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEYFPAvailable sinceJune 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-eYFP (AAV8)
Viral Prep#117382-AAV8PurposeReady-to-use AAV8 particles produced from hSyn1-eYFP (#117382). In addition to the viral particles, you will also receive purified hSyn1-eYFP plasmid DNA. hSyn-driven eYFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagseYFPAvailable sinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP (AAV5)
Viral Prep#104055-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CAG-eYFP (#104055). In addition to the viral particles, you will also receive purified pAAV-CAG-eYFP plasmid DNA. CAG-driven eYFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEYFPAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TagGFP2
Plasmid#121426PurposeTAgGFP2 was amplified from pLenti-Origene-Nrf21 and inserted into XhoI and EcoRI digested pLenti-Origene-Nrf21.DepositorInsertempty TagGFP2
UseLentiviralTagsTagGFP2ExpressionMammalianMutationPromoterCMVAvailable sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-DIO-eYFP (AAV1)
Viral Prep#117383-AAV1PurposeReady-to-use AAV1 particles produced from TRE-DIO-eYFP (#117383). In addition to the viral particles, you will also receive purified TRE-DIO-eYFP plasmid DNA. Tet-inducible, Cre-dependent eYFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterTRETagseYFP (Tet-inducible, Cre-dependent)Available sinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-STAT3-linker-TagGFP2
Plasmid#121427PurposeWT STAT3 inserted using Infusion Cloning into MluI and EcoRI digested pLenti-Origene-Nrf21.DepositorInsertSTAT3-linker-TagGFP2
UseTagsTagGFP2ExpressionMammalianMutationPromoterCMVAvailable sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-eYFP (AAV PHP.eB)
Viral Prep#117382-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from hSyn1-eYFP (#117382). In addition to the viral particles, you will also receive purified hSyn1-eYFP plasmid DNA. hSyn-driven eYFP expression. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagseYFPAvailable sinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAG-NLS-GFP (AAV PHP.eB)
Viral Prep#104061-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from CAG-NLS-GFP (#104061). In addition to the viral particles, you will also receive purified CAG-NLS-GFP plasmid DNA. CAG-driven NLS-GFP expression. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-eYFP (AAV Retrograde)
Viral Prep#117382-AAVrgPurposeReady-to-use AAV Retrograde particles produced from hSyn1-eYFP (#117382). In addition to the viral particles, you will also receive purified hSyn1-eYFP plasmid DNA. hSyn-driven eYFP expression. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagseYFPAvailable sinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP (AAV Retrograde)
Viral Prep#104055-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-CAG-eYFP (#104055). In addition to the viral particles, you will also receive purified pAAV-CAG-eYFP plasmid DNA. CAG-driven eYFP expression control. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEYFPAvailable sinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP (AAV PHP.eB)
Viral Prep#104055-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-CAG-eYFP (#104055). In addition to the viral particles, you will also receive purified pAAV-CAG-eYFP plasmid DNA. CAG-driven eYFP expression control. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEYFPAvailable sinceJune 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgGAL4
Plasmid#121514PurposesgGAL4 control. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgGAL4
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgSTAT3-1
Plasmid#121425PurposesgSTAT3-1 sequence: GTCAGGATAGAGATAGACCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgSTAT3-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-2
Plasmid#121423PurposesgYAP-2 sequence: GAGATGACTTCCTGAACAGTG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-2
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-Flex-rev-GFPFANACfullWT
Plasmid#126551PurposeAAV Flex reverse plasmid with the coding sequence of eGFP fused to the N-term of the FMRFamide gated Na channelDepositorInserteGFP N-terminal fused to FMRFamide gate sodium channel
UseAAVTagsExpressionMutationPromoterAvailable sinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJAK175
Plasmid#178601PurposepAP259 derived plasmid encoding a xylose inducible BitlucOptDepositorInsertBitlucopt
UseTagsExpressionBacterialMutationPromoterPxylAvailable sinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-EYFP (AAV PHP.V1)
Viral Prep#104052-AAVPHP.V1PurposeReady-to-use AAV PHP.V1 particles produced from pAAV-CAG-DIO-EYFP (#104052). In addition to the viral particles, you will also receive purified pAAV-CAG-DIO-EYFP plasmid DNA. CAG-driven, Cre-dependent expression of EYFP. These AAV were produced with the PHP.V1 serotype, which permits efficient transduction of brain vascular cells. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEYFP (Cre-dependent)Available sinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO mTRPM7
Plasmid#45482DepositorInsertTRPM7 (Trpm7 Mouse)
UseTetracycline inducibleTagsFlagExpressionMammalianMutationPromoterTetracycline-controlled CMVAvailable sinceMay 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pWP001
Plasmid#178596PurposepAF256 derived plasmid encoding a xylose inducible CD16/50L CBD-SmBiT and LgBiTDepositorInsertCBD-SmBiT/LgBiT
UseTagsExpressionBacterialMutationPromoterPxylAvailable sinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-psMEK1tight
Plasmid#89362PurposeA lenti-viral vector expressing photoswitchable MEK1 with minimum basal activity in mammalian cellsDepositorInsertpsMEK1tight (MAP2K1 Human, Synthetic)
UseLentiviralTagsHuman influenza hemagglutinin (HA) tag and pdDron…ExpressionMammalianMutationPromoterCMVAvailable sinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-psMEK2
Plasmid#89363PurposeA lenti-viral vector expressing photoswitchable MEK2 in mammalian cellsDepositorInsertpsMEK2 (MAP2K2 Human, Synthetic)
UseLentiviralTagsHuman influenza hemagglutinin (HA) tag and pdDron…ExpressionMammalianMutationPromoterCMVAvailable sinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-psMEK1
Plasmid#89361PurposeA lenti-viral vector expressing photoswitchable MEK1 in mammalian cellsDepositorInsertpsMEK1 (MAP2K1 Human, Synthetic)
UseLentiviralTagsHuman influenza hemagglutinin (HA) tag and pdDron…ExpressionMammalianMutationPromoterCMVAvailable sinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AntiHer2-LC122-TAG
Plasmid#226839PurposeContains trastuzumab with a TAG codon at position 122 of the light chain for ncAA incorporationDepositorInsertsanti-HER2 light chain
anti-HER2 heavy chain
UseAffinity Reagent/ AntibodyTagsExpressionMammalianMutationamino acid 122 of light chain mutated to TAGPromoterAvailable sinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AntiHer2-HC121-TAG
Plasmid#226836PurposeContains trastuzumab with a TAG codon at position 121 of the heavy chain for ncAA incorporationDepositorInsertsanti-HER2 light chain
anti-HER2 heavy chain
UseAffinity Reagent/ AntibodyTagsExpressionMammalianMutationamino acid 121 of heavy chain mutated to TAGPromoterAvailable sinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AntiHer2-HC197-TAG
Plasmid#226838PurposeContains trastuzumab with a TAG codon at position 197 of the heavy chain for ncAA incorporationDepositorInsertsanti-HER2 light chain
anti-HER2 heavy chain
UseAffinity Reagent/ AntibodyTagsExpressionMammalianMutationamino acid 197 of heavy chain mutated to TAGPromoterAvailable sinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PPO-Venus
Plasmid#139502PurposeExpresses Venus-tagged parapinopsin in mammalian cells for photoswitchable control of inhibitory GPCR signaling cascades.DepositorInsertparapinopsin
UseTagsVenus tag following 3x Ala linkerExpressionMammalianMutationPromoterAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PPO-mScarlet
Plasmid#139503PurposeExpresses mScarlet-tagged parapinopsin in mammalian cells for photoswitchable control of inhibitory GPCR signaling cascades.DepositorInsertparapinopsin
UseTagsmScarlet following Gly-Gly-Ser linkerExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
EcMscS
Plasmid#78555PurposeE. coli Mechanosensitive Channel of Small ConductanceDepositorInsertMechanosensitive Channel of Small Conductance
UseTags6x Histidine TagExpressionMutationPromoterT7 PromoterAvailable sinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-PPO-Venus
Plasmid#139505PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the Ef1a promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV8 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianMutationPromoterEf1aAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-PPO-Venus
Plasmid#139504PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV5Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 hPHGDH
Plasmid#154916PurposeDoxycyclin inducible expression of human PHGDHDepositorInsertPHGDH (PHGDH Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST PHGDH
Plasmid#154917PurposeExpresses human PHGDHDepositorInsertPHGDH (PHGDH Human)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only