We narrowed to 4,107 results for: lenti crispr plasmid
-
Plasmid#60904PurposeThe plasmid encodes a antibody that binds to the GCN4 peptide from the SunTag system, and is fused to a transcriptional activation domain VP64DepositorInsertscFv-GCN4
UseLentiviralExpressionMammalianAvailable SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
hu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vector
Plasmid#154430Purposehu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vectorDepositorInserthu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vector
UseAAV and CRISPRExpressionMammalianMutationVRQR point mutations in SpCas9Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLeGO.sgGata1.4.RUNX1A.iG2
Plasmid#181976Purposegene knock out of mouse GATA1, overexpression of 3xFLAG-RUNX1A (human)DepositorAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
EF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
Plasmid#107311PurposeEncoding scFv-p65-HSF1 driven by EF1α promoterDepositorInsertEF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
UseLentiviralExpressionMammalianAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mClover3_LacZ
Plasmid#155103Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_LacZ_sgRNA
Plasmid#155108Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_Luciferase_sgRNA
Plasmid#155109Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting LuciferaseDepositorInsertLuciferase_sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.13.EFS-NS.H2B-RFP
Plasmid#170388PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.4.EFS-NS.H2B-RFP
Plasmid#170365PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.3.EFS-NS.H2B-RFP
Plasmid#170364PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_3-As
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_antiCD19_eZ3_Gal4VP64
Plasmid#169917PurposeExpression of a synNotch receptor containing antiCD19, a zebrafish Notch3 core with an additional EGF repeat, and Gal4VP64.DepositorInsertantiCD19-Notch3-GL4VP64
UseLentiviralExpressionMammalianMutationAdditional EGF repeat between the extracellular d…PromoterPGKAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC2_1k)-PGKpuro2ABFP-W
Plasmid#208416PurposeLentiviral gRNA plasmid targeting human BIRC2 gene, co-expression of BFP tagDepositorInsertBIRC2 (BIRC2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only