We narrowed to 14,725 results for: egf
-
Plasmid#222306PurposeSynchronize the trafficking of gp135/podocalyxin from the ER.DepositorInsertStreptavidin-KDEL and gp135 fused to SBP-EGFP (PODXL Rabbit)
ExpressionMammalianMutationsignal peptide removedPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSMPUW_6.19_Ex_Ef1a-EGFP-HA-SV40-Zeo
Plasmid#128455Purposelentiviral expression vector with Ef1a promoter, EGFP gene, C-terminal HA tag, SV40 promoter, and Zeo Resistance geneDepositorInsertEf1a promoter, EGFP gene, C-terminal HA tag, SV40 promoter, and Zeocin Resistance gene
UseLentiviralAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH_Str-KDEL_ManII-SBP-EGFP
Plasmid#65258Purposesynchronize trafficking of ManII from the ER (RUSH system)DepositorInsertStreptavidin-KDEL and truncated Mannosidase II
UseLentiviralTagsEGFP and Streptavidin Binding Protein (SBP)Mutationcontains only amino acids 1 to 116 of ManIIPromoterCMVAvailable SinceAug. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_TNF-SBP-EGFP
Plasmid#65278Purposesynchronize trafficking of TNF from the ER (RUSH system)DepositorInsertTNF (TNF Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianPromoterCMVAvailable SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EGFP-Rac1-Q61L
Plasmid#12981DepositorInsertRac1 constitutively active (RAC1 Human)
TagsEGFPExpressionMammalianMutationQ61L Constitutively activeAvailable SinceOct. 27, 2006AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-EGFP-NLS
Plasmid#86677PurposeExpresses nuclear-localized GFP after lentiviral transduction. Can be used to monitor GFP leakage into the cytosol following nuclear envelope rupture events.DepositorInsertEGFP-NLS
UseLentiviralAvailable SinceApril 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-25xAARE-minP-EGFP
Plasmid#159666PurposeEGFP reporter plasmid containing 25 tandem repeats of the amino acid response element (AARE)DepositorInsert25xAARE-minP-EGFP
UseLentiviralExpressionMammalianAvailable SinceMarch 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PSMD2
Plasmid#161917PurposeExpresses human PSMD2 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorInsert26S proteasome non-ATPase regulatory subunit 2 (PSMD2 Human)
TagsGFP-FLAGExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT_CMV_NES-Kinprola_PKA-mEGFP
Plasmid#233353PurposeCMV driven expression of the PKA activity recorder Kinprola_PKA in mammalian cell lines fused to mEGFPDepositorInsertNES-Kinprola_PKA-mEGFP
TagsNES and mEGFPExpressionMammalianPromoterCMVAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-camk2a
Plasmid#104589PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse camk2aDepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Mouse)
UseAAV, CRISPR, and Mouse TargetingPromoterNoneAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV Ef1a-EGFP-WPRE
Plasmid#135428PurposeCan be used to express EGFP. Can also be used to create adeno-associated virus for delivery of the EGFP sequenceDepositorInsertEGFP
UseAAVExpressionMammalianPromoterEF1aAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RNaseHI-NES-EGFP
Plasmid#196701PurposePlasmid for stable expression of wild type bacterial RNase HI tagged with NES and EGFP that can be used to specifically degrade the DNA-RNA hybrids in the cytoplasm.DepositorInsertbacterial RNaseHI
UseLentiviralAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-EGFP-Hygro
Plasmid#184593PurposeEGFPDepositorInsertEGFP
UseLentiviralPromoterCMVAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
IRE1-2EGFP-ter-kanMX4
Plasmid#184766PurposeIntegration of 2xGFP tag at IRE1 C terminus. Potential indicator of UPR activation. Uses antibiotic resistance marker kanMX4.DepositorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPyCAG-EGFP-TM-IRES-Pac
Plasmid#183603PurposeMammalian expression vector for membrane-tethered EGFP from the CAG promoter. Confers puromycin resistance.DepositorInsertEGFP-TM
TagsHuman PDGFRB transmembrane domain and Mouse IgGK …ExpressionMammalianPromoterCAGAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-dCas9-dMQ1-EGFP
Plasmid#89637PurposeTargeted CpG methylationDepositorInsertsite-specific DNA-methyltransferase SssI
UseCRISPRTags3*FLAG, 6*His, and T2A-EGFPExpressionMammalianMutationC141S, TGC-->TCC; S317A, AGC-->GCCPromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eGFP-PC1-3HA
Plasmid#108406PurposeCan be used to generate stable Flp-In cells with tetracycline-inducible human PC1 expression.DepositorAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBabe EGFR(L858R/T790M)
Plasmid#32073DepositorAvailable SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-hygro-eGFP-HEC1
Plasmid#114027PurposeInducible expression of eGFP-tagged HEC1 in FLPin Trex cell linesDepositorInserteGFP-HEC1 - Wildtype (NDC80) (NDC80 Human)
ExpressionMammalianAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only