We narrowed to 4,880 results for: pir
-
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-rS2d-HexaPro
Plasmid#183515PurposeMammalian cell expression of SARS-CoV-2 Spike protein rS2d-HexaPro with (682-685) furin side replaced with GSAS and mutation S383C, D985C, F817P, A892P, A899P, A942P, K986P,V987PDepositorInsertSpike (S-GSAS-rS2d.HexaPro) (S Severe acute respiratory syndrome coronavirus 2)
UseTags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-AVI
Plasmid#160476PurposeExpresses SARS-CoV-2 RBD domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-AVI
Plasmid#160475PurposeExpresses SARS-CoV-2 NTD domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-AVI
Plasmid#160474PurposeExpresses SARS-CoV-2 S2P protein with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationPromoterAvailable sinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR-OMICRON
Plasmid#180424PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side intactDepositorInsertSpike (S-RRAR-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON.BA.2
Plasmid#184829PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON.BA.2 with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-OMICRON.BA.2 (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.617.2.v1
Plasmid#182575PurposeMammalian cell expression of SARS-CoV-2 Spike protein Delta variant, furin side replaced by GSAS, 2 Proline at 986 and 987 plus T19R-G142D-del156/157-R158G-L452R-T478K-D614G-P681R-D950NDepositorInsertSpike S-GSAS-B.1.617.2.v1 (T19R-G142D-Del156/157-R158G-L452R-T478K-D614G-P681R-D950N) (S Severe acute respiratory syndrome coronavirus 2)
UseTags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-AVI
Plasmid#160477PurposeExpresses SARS-CoV-2 RBD-SD1 domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475RG502R-AVI
Plasmid#160480PurposeExpresses SARS-CoV-2 RBD-L455RA475RG502R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475RG502R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine, Alanine 475 to A…PromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RG496R-AVI
Plasmid#160479PurposeExpresses SARS-CoV-2 RBD-L455RG496R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RG496R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Glyci…PromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475R-AVI
Plasmid#160478PurposeExpresses SARS-CoV-2 RBD-L455RA475R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Alani…PromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Δ18 B.1.1.529
Plasmid#179907PurposeEncodes SARS-CoV-2 B.1.1.529 Spike Protein lacking 18 C-terminal amino acids for pseudovirus productionDepositorInsertSARS-CoV-2 B.1.1.529 Spike truncated to remove 18 amino acids (S Severe acute respiratory syndrome coronavirus 2)
UseTagsExpressionMammalianMutationA67V; Δ69-70; T95I; G142D; Δ143-145; N211I; Δ212;…PromoterCAGAvailable sinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-2P-OMICRON
Plasmid#180593PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertSpike (S-GSAS-2P-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only