We narrowed to 5,482 results for: PID;
-
-
pX330 PLIN2
Plasmid#202196PurposepX330 backbone expressing sgRNA to edit the C-terminus of human PLIN2DepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCavin1b in pT3TS-Dest
Plasmid#194295PurposeIn vitro transcription of mKate2 tagged zebrafish cavin1b from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone LACDepositorInsertcavin1b (cavin1b Zebrafish)
UseIn vitro transcription of mrnaAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
ER-mGreenLantern
Plasmid#164463PurposeLocalization and retention of mGreenLantern fluorescent protein in the ERDepositorInsertmGreenLantern
TagsCalreticulin and KDELExpressionMammalianMutationClover-F64L/S72A/E124V/N149K/I167T/S175G/A206K/L2…PromoterCMVAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMGS56 (GFP-ARF16-PB1-P2A-OsTIR1)
Plasmid#129668PurposeA repair construct to express GFP-ARF16-PB1 and OsTIR1 under the control of the CMV promoter from the human AAVS1 locusDepositorInsertOsARF16-PB1 domain
TagsGFPExpressionMammalianAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-hNF2
Plasmid#107150Purposemammalian expressionDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmiRFP670-C1-Nir1-LNS2
Plasmid#220085Purposehigh affinity PA biosensor with far-red fluorophoreDepositorInsertPITPNM3 (PITPNM3 Human)
TagsiRFP670-GGSGGMExpressionMammalianMutationamino acids 613-897PromoterCMVAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
mKate2-P2A-APEX2-2xFYVE_hrs
Plasmid#67663PurposeMammalian expression vector driving APEX2-2xFYVE (2xMouse FYVE domain from HRS, [marks PI3P] fused to EM peroxidase marker). Also contains bicistronially expressed cytoplasmic red reporter.DepositorInsertmKate2-P2A-APEX2-2xFYVE
ExpressionMammalianPromoterCMVAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-EGFP-Vasa 463-661 MUT (F504E) (HK196)
Plasmid#206434PurposeVasa 463-661 expression in Schneider cells for imagingDepositorAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Flag-hKlf4
Plasmid#20074DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 WT 2014 EBOV + Mucin-Like Domain
Plasmid#85794PurposeEbola Virus (Makona) Glycoprotein in CMV driven mammalian expression vectorDepositorInsertMakona Ebola Virus Glycoprotein
ExpressionMammalianPromoterCMV IEAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-HLP-SACas9-HA-OLLAS-spA
Plasmid#206860PurposeAn AAV plasmid with U6 promoter driving a gRNA against LDLR and liver specific HLP promoter driving SaCas9DepositorInsertmLdlr gRNA (Ldlr Mouse)
UseAAV and CRISPRAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYTRW22K_7Ti1
Plasmid#177293Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcR and LacZDepositorInsertlacZ
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-TCF7
Plasmid#79498PurposeMultiSite Gateway entry clones, second fragment (attL5, attL2) Human TCF7 CDSDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
AA063
Plasmid#216020PurposeFragmid fragment: (Cas protein) nickase Cas for prime editingDepositorHas ServiceCloning Grade DNAInsertnCas9-SpRY (H840A)_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA183
Plasmid#216025PurposeFragmid fragment: (Cas protein) for prime editing; R221K;N394K for increased efficiencyDepositorHas ServiceCloning Grade DNAInsertnCas9 (H840A)_v2.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA062
Plasmid#216019PurposeFragmid fragment: (Cas protein) nickase Cas for prime editingDepositorHas ServiceCloning Grade DNAInsertnCas9-SpG (H840A)_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA060
Plasmid#216017PurposeFragmid fragment: (Cas protein) nickase Cas for prime editingDepositorHas ServiceCloning Grade DNAInsertnCas9 (H840A)_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
CoV2-N-B.1.1.7
Plasmid#177958PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Nucleocapsid (D3L, R203K, G204R, S235F). Used for generating RNA packaging virus-like particles.DepositorInsertSARS-CoV-2 Nucleocapsid (D3L, R203K, G204R, S235F) (N )
ExpressionMammalianMutationD3L,R203K,G204R,S235FAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only
