We narrowed to 501 results for: CAG synthetic promoter
-
Plasmid#118635PurposeTransient transfection; Expresses RBFOX1N-dCasRx-C; CAGGS promoterDepositorInsertRBFOX1N-dCasRx-C
UseCRISPRExpressionMammalianPromoterCAGGSAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
phU6 ST
Plasmid#188712PurposesgRNA plasmid encoding hU6 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmU6 ST
Plasmid#188713PurposesgRNA plasmid encoding mU6 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
phH1 ST
Plasmid#188715PurposesgRNA plasmid encoding hH1 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmU6 NFATC2
Plasmid#188709PurposesgRNA plasmid encoding mU6 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY105
Plasmid#130939PurposeEngineered sgRNA-LEA3 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEA3
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_sgGFP4
Plasmid#119876PurposegRNA expression vectorDepositorInsertsgGFP
UseLentiviralExpressionMammalianAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-scramble
Plasmid#62285Purposeexpression of scramble sgRNA from the arabinose-inducible promoterDepositorInsertscramble sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1T
Plasmid#62256Purposeexpression of A1T sgRNA from the arabinose-inducible promoterDepositorInsertA1T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4NT
Plasmid#62261Purposeexpression of A4NT sgRNA from the arabinose-inducible promoterDepositorInsertA4NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3T
Plasmid#62260Purposeexpression of A3T sgRNA from the arabinose-inducible promoterDepositorInsertA3T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848)
Plasmid#181745Purposedual T7 promoter vector for bacterial expression of SpCas9 with a c-terminal NLS and 3xFLAG tag, along with an SpCas9 sgRNA targeting EGFP site 1DepositorInserthuman/zebrafish codon optimized SpCas9
UseIn vitro transcription; t7 promoterTagsNLS(SV40)-3xFLAGExpressionBacterialPromoterT7Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
ISDra2-TnpB-mCherry-U6-ωRNA*
Plasmid#212967PurposeExpression vector for expression of ISDra2-TnpB driven by chicken β-actin promoter and mCherry driven by CMV promoterDepositorInsertsISDra2-TnpB-T2A-mCherry
ωRNA*
UseCRISPRTagsNLS and NLS-FLAGExpressionMammalianPromoterCAG, T7 and U6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-SDHB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172670PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human SDHB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertSDHB pegRNA and SDHB_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-ALDOB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172668PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human ALDOB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertALDOB pegRNA and ALDOB_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA3
Plasmid#136458PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Empty Bridge Control Zfp462-Klf4SE
Plasmid#127666PurposeEncodes for 4 gRNAs expressed from their individual hU6 promoters. Two gRNAs target the Zfp462 promoter while the other two target the Klf4 stretch enhancer.DepositorInsertgRNAs 129, 135, 115, 117
UseCRISPRExpressionMammalianPromoterhU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crBACH1-array_EF1a-BFP
Plasmid#224787PurposeBACH1 targeting crRNA array for RfxCas13d expressed from multiple hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrBACH1-1, crBACH1-2, crBACH1-3,
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGG198
Plasmid#165605PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with two hEGFP protospacers: PS1(upstream of promoter with 'CAGCG' PAM)-lac-PS2(downstream with 'CGGCG' PAM)-HIS3 and GFPDepositorInserthEGFP protospacer ('CGGCG' PAM) downstream of the HIS3/GFP promoter
UseSynthetic BiologyExpressionBacterialMutationSecondary protospacer ('CGGCG' PAM) ins…PromoterlacAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only