We narrowed to 10,368 results for: Coli
-
Plasmid#67012PurposeExpresses malE-ELP[AV-60] in E. coliDepositorInsertmalE-ELP[AV-60]
TagsHis6 and malE-Factor XaExpressionBacterialPromotertacAvailable SinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Violet
Plasmid#160447PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Violet chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Violet
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1E
Plasmid#160442PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1 chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKFSS1_2
Plasmid#118227PurposeEmpty E. coli - B. burgdorferi shuttle vector; streptomycin resistantDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSG22-pBAD-TetR
Plasmid#102451PurposeExpresses TetR protein in E. coli. The expression is controlled by a pBAD promoter.DepositorAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOGG005
Plasmid#113980PurposeLevel 1 high copy number vector for E. coli expressionDepositorTypeEmpty backboneExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-mCherry(-6)
Plasmid#205045PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertmCherry(-6)
TagsMGHHHHHGGExpressionBacterialAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26-SS-352
Plasmid#68791PurposeZF9 Op x6 -- GFP-IRES-NTRDepositorInsertsZF9 Op 6x
EGFP
Nitroreductase
TagsIRESExpressionMammalianAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a human Tankyrase2 full length Y920E
Plasmid#132639Purposeexpresses human Tankyrase2 full length Y920E in E. coliDepositorInsertTankyrase2 Y920E
ExpressionBacterialAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUMV19
Plasmid#67161Purposeinducible operation of the mevalonate pathway in E. coliDepositorInsertthe mevalonate pathway genes
ExpressionBacterialPromoterlacZAvailable SinceOct. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSG28-J23151-AraC
Plasmid#102453PurposeExpresses AraC protein in E. coli. The expression is controlled by a constitutive promoter.DepositorAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET22b_pScaC-SNAP_6xHis
Plasmid#228835PurposeE. coli expression of the SNAP-tagged ScaC passenger domainDepositorInsertScaC
TagsSNAPtag-TEV-6xHisExpressionBacterialMutationaa 33-223Available SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet1_CylLS_CylM
Plasmid#208760PurposeExpresses modified cytolysin S (mCylLS) in E. coliDepositorInsertsCylLS
CylLM
TagsHisx6 TagExpressionBacterialPromoterT7Available SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNIC-CFP
Plasmid#173074PurposeExpression vector for E. coli producing target protein with N-terminal CFP fusionDepositorTypeEmpty backboneTagsmCeruleanExpressionBacterialAvailable SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBSV2_2
Plasmid#118226PurposeEmpty E. coli - B. burgdorferi shuttle vector; kanamycin resistantDepositorTypeEmpty backboneExpressionBacterialAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_LolT_C41S
Plasmid#211789PurposeExpression plasmid in E. coli BL21(DE3) , which can be used for expression and purification to get protein LolT_C41SDepositorInsertlolt mutant
TagsHis tagExpressionBacterialPromoterT7 promoterAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Magenta
Plasmid#160446PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Magenta chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Magenta
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-hsGFP
Plasmid#64911PurposeEncodes a Fluorescent Reporter for Hydrogen Sulfide in E. ColiDepositorInserthsGFP
TagsHis TagExpressionBacterialMutationChromophore tyrosine of the protein mutated to TA…PromoteraraBADAvailable SinceMay 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
A0A075HNX4
Plasmid#177695Purposeexpresses a fatty alcohol oxidase in E. coliDepositorInsertLong chain alcohol oxidase
Tags10xHisExpressionBacterialPromoterT7Available SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQDKN0248
Plasmid#162313PurposeReporter plasmid for T7-driven E. coli cell-free protein synthesis with detection via HiBiTDepositorInsertT7prom-RBS-sfGFP-HiBiT
UseSynthetic BiologyAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET51b_SNAP-ecDHFR
Plasmid#187108PurposeExpression of SNAP-ecDHFR fusion in bacteriaDepositorInsertSNAP-ecDHFR
TagsHisx10 and StrepExpressionBacterialPromoterT7Available SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1_CoumRS
Plasmid#64882PurposeExpresses Coumarinyl- tRNA synthetaseDepositorInsertCoum_RS
TagsFlagPromoterCMVAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
vgCam-pRSETb
Plasmid#193362PurposeA FRET-based calcium probe using SumireDepositorInsertvgCam
UseE.coli expressionTagsHis X6 tag and Strep tagPromoterT7Available SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAllet
Plasmid#202560PurposeE. coli cloning vector with large MCS (50+ unique restriction sites)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherryS131C
Plasmid#48732PurposeExpresses mCherryS131C in E. coli cellsDepositorInsertmCherryS131C
Tags6xHisExpressionBacterialMutationchanged serine 131 to cysteinePromoterT5Available SinceOct. 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Pink
Plasmid#160445PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Pink chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Pink
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ChmN
Plasmid#221348PurposeExpress ChmN in E. coliDepositorInsertchmN
TagsHis6ExpressionBacterialAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKL13-MgtC bb118
Plasmid#158982PurposeConstitutive expression (sigma 70 promoter) of mgtC protein from S. Typhimurium in E. coli.DepositorInsertmgtC
ExpressionBacterialPromoterBba_J23118 (sigma 70)Available SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0245
Plasmid#162284PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-CCAT. Generates plasmids for T7-driven E. coli cell-free protein synthesisDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only