We narrowed to 11,549 results for: phen
-
Plasmid#222004PurposeExpresses mitochondrial cytosine base editor arm in mammalian cellsDepositorInsertCOX8A MTS-3xFLAG-TALE NT-alphaN-TL1 TALE repeats (alpha-3_NC left)-TALE CTD-DddA11 1397N-UGI-ATP5B 3'UTR
UseCRISPRTags3xFLAGExpressionMammalianMutationTALE: Q231R, W232G, S233A | DddA: S1330I, A1341V,…PromoterCMVAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTE5418_pMBP-GlcR
Plasmid#221192PurposeExpression vector for 10x-MBP-GlcR (MGlcR). GlcR is a glycolate-responsive transcriptional repressor and the gene product of pden4400 from Paracoccus denitrificans, codon optimized for E. coli.DepositorInsertglcR (pden4400 from Paracoccus denitrificans)
Tags10x His tag with E. coli maltose binding protein …ExpressionBacterialPromoterT7 promoter and T7 promoter-lacOAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGST-WzzE
Plasmid#196662PurposeExpression of N-terminally GST-tagged WzzE from Pectobacterium atrosepticum in E.coliDepositorInsertWzzE
TagsTEV-cleavable GSTExpressionBacterialMutationValine insertion at position 2.PromoterT7Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHis-mCherry-WzzE
Plasmid#196663PurposeExpression of N-terminally His6-mCherry-tagged WzzE from Pectobacterium atrosepticum in E.coliDepositorInsertWzzE
TagsHis and mCherryExpressionBacterialMutationValine insertion at position 2 of WzzE.PromoterT7Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPglL-strep-mCherry
Plasmid#196664PurposeExpression of C-terminally distrep tag II-mCherry-tagged PglL from Neisseria meningitidis in E.coliDepositorInsertPglL
TagsTEV-cleavable distrep tag II and mCherryExpressionBacterialPromoterT7Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
FKBP-GFP-LAP2beta
Plasmid#222416PurposeTo express LAP2beta with GFP and a FKBP tag for rapamycin-induced heterodimerisation in mammalian cellsDepositorAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
FKBP-GFP-BAF
Plasmid#222414PurposeTo express BAF with GFP and a FKBP tag for rapamycin-induced heterodimerisation in mammalian cellsDepositorAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR051
Plasmid#185029Purpose400 nt l31 promoter region, l31 5'UTR with nt. 47-51 and 80-84 mutated, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides 47-51 & 80-84 mutated rpmE 5'…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR052
Plasmid#185030Purpose400 nt l31 promoter region, l31 5'UTR with nt. 56-61 and 68-73 mutated, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides 56-61 and 68-73 mutated in rpmE 5…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR064
Plasmid#185031Purpose400 nt l31 promoter region, scrambled 5'UTR, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides of rpmE 5'UTR scrambled, Only fi…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR102
Plasmid#185033Purpose400 nt l31 promoter region, l31 5'UTR U54C mutation, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationU54C mutation of rpmE 5'UTR, Only first 90 n…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR106
Plasmid#185036Purpose400 nt l31 promoter region, l31 5'UTR G79U mutation, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationG79U mutation of rpmE 5'UTR, Only first 90 n…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR116
Plasmid#185040Purpose400 nt l31 promoter region, l31 5'UTR U58C and U70C, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationU58C and U70C of rpmE of 5'UTR, Only first 9…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR017-L31-sfGFP
Plasmid#185024Purpose400 nt l31 promoter region, l31 5'UTR, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationOnly first 90 nt of rpmE coding presentAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR039
Plasmid#185025Purpose400 nt l31 promoter region, l31 5'UTR with nt. 1-31 deleted, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides 1-31 deleted from rpmE 5'UTR, On…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR040
Plasmid#185026Purpose400 nt l31 promoter region, l31 5'UTR with nt. 35-46 deleted, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides 35-46 deleted from rpmE 5'UTR, O…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR041
Plasmid#185027Purpose400 nt l31 promoter region, l31 5'UTR with nt. 47-54 & 76-86 deleted, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides 47-54 & 76-86 deleted from rpmE …Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-tac-EcTyrRS-VSMA*-lpp-tRNA_CUA^EcTyr
Plasmid#218766Purposeencodes EcTyrRS-VSMA* and EcTyr-tRNA-TAGDepositorInsertEcTyrRS-VSMA*
ExpressionBacterialMutationY37V, D167G, D182S, F183M, L186A, D265RPromotertacIAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-His10-DDX5(kf)-SNAP
Plasmid#166152PurposeExpression of N. furzeri DDX5 in E. coliDepositorInsertDDX5
TagsHis10 and SNAPExpressionBacterialPromoterT7Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET151-GyrA_F164R238
Plasmid#216230PurposeS. aureus USA300 GyrA mutant F164 R238 residues codon-optimized for E. coliDepositorInsertDNA gyrase
Tags6xHisExpressionBacterialMutationChanged arginine 238 to serine, phenylalanine 168…PromoterT7Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRF2 CTF-FLAG
Plasmid#217695PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRF2 (ADGRF2 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-429Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRE4 CTF-FLAG
Plasmid#217692PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRE4 (ADGRE4P Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-173Available SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC086
Plasmid#202213PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Gentamicin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertpBCC25, pBCC33, pBCC55, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC091
Plasmid#202218PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Tetracyline selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertpBCC25, pBCC30, pBCC55, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC100
Plasmid#202226PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Kanamycin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertpBCC25, pBCC32, pBCC55, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF702
Plasmid#209650PurposeSuicide plasmid carrying a neomycin resistance marker flanked by homologous regions of the Mth60-fimbria encoding operon of Methanothermobacter thermautotrophicusDepositorInsertsDownstream homologous region
thermostable neomycin phosphotransferase gene
Upstream homologous region
Available SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2
Plasmid#203164PurposeYeast expression vector; To express proteins under control of TDH3 promoter and terminator using methionine selectionDepositorTypeEmpty backboneExpressionYeastAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYG215
Plasmid#200837PurposeTranscribes a glmZ' (1-146)-gfp fusion. gfp can be replaced via AgeI/XbaI-sites with gene of interest to release its RNA with a 5' monophosphate upon cleavage.DepositorInsertglmZ (glmZ Escherichia coli str. K-12 substr. MG1655)
UseSynthetic BiologyTagsGFPExpressionBacterialPromoterP-LlacO-1Available SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC57-RPLP15UTR-hRluc-A60
Plasmid#182639PurposeTranscription template plasmid for RPLP1 5'UTR followed by Renilla luciferase open reading frame and polyA sequenceDepositorInsertRenilla luciferase
UseLuciferaseExpressionMammalianMutationThe transcription is driven by a T7 promoter, pai…Available SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas12(PI)
Plasmid#186448PurposeEncodes inactive Cas12a containing mutation in the PI domain (K613A, K617A) from F. novicida (type V-A)DepositorInsertCas12a (PI)
UseCRISPRMutationK613A, K617APromoterT7Available SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas12b
Plasmid#186449PurposeEncodes Cas12b from A. acidoterrestris (type V-B)DepositorInsertCas12b
UseCRISPRPromoterT7Available SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas12b(PI)
Plasmid#186451PurposeEncodes inactive Cas12b containing mutation in the PI domain (R122A, G143P) from A. acidoterrestris (type V-B)DepositorInsertCas12b (PI)
UseCRISPRMutationR122A, G143PPromoterT7Available SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NvM-DmBam_1-140_AG
Plasmid#148832PurposeBacterial Expression of DmBam_1-140DepositorInsertDmBam_1-140 (bam Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-DmNot1_1468-1719_AF
Plasmid#148740PurposeBacterial Expression of DmNot1_1468-1719DepositorInsertDmNot1_1468-1719 (Not1 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-DmRoquin_702-819-del790-812-GB1His6_AE
Plasmid#148623PurposeBacterial Expression of DmRoquin_702-819-del790-812DepositorInsertDmRoquin_702-819-del790-812 (roq Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-DmRoquin_702-819-del725-755-GB1His6_AE
Plasmid#148622PurposeBacterial Expression of DmRoquin_702-819-del725-755DepositorInsertDmRoquin_702-819-del725-755 (roq Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-HsNot1iso1_1833-2361_U
Plasmid#147728PurposeBacterial Expression of HsNot1iso1_1833-2361DepositorInsertHsNot1iso1_1833-2361 (CNOT1 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NvH-HsNot1iso1_1565-2371_U
Plasmid#147730PurposeBacterial Expression of HsNot1iso1_1565-2371DepositorInsertHsNot1iso1_1565-2371 (CNOT1 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NvHN-DmXRN1_1312-1383_N
Plasmid#147051PurposeBacterial Expression of DmXRN1_1312-1383DepositorInsertDmXRN1_1312-1383 (pcm Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NvHN-DmXRN1_1323-1383_N
Plasmid#147053PurposeBacterial Expression of DmXRN1_1323-1383DepositorInsertDmXRN1_1323-1383 (pcm Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpH-CeeIF4E3_1-215opt-V58AI74A_AB
Plasmid#148368PurposeBacterial Expression of CeeIF4E3_1-215-V58AI74ADepositorInsertCeeIF4E3_1-215-V58AI74A
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-HsNot1iso1_1833-2361-H1949D_AB
Plasmid#148335PurposeBacterial Expression of HsNot1iso1_1833-2361-H1949DDepositorInsertHsNot1iso1_1833-2361-H1949D (CNOT1 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-HsNot1iso1_1833-2361-V1880E_AB
Plasmid#148336PurposeBacterial Expression of HsNot1iso1_1833-2361-V1880EDepositorInsertHsNot1iso1_1833-2361-V1880E (CNOT1 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRB116.2
Plasmid#181946PurposeaTc-inducible expression of TorR with C-terminal mNeonGreen fusion. Also contains mCherry under TorR-controlled promoter PtorCAD129DepositorInsertTagsmNeonGreenExpressionBacterialPromoterTorR-mNG-PLtetO-1; mCherry-PtorCAD129; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRB120.2
Plasmid#181947PurposeaTc-inducible expression of TorR with N-terminal mNeonGreen fusion. Also contains mCherry under TorR-controlled promoter PtorCAD129DepositorInsertTagsmNeonGreenExpressionBacterialPromotermNG-TorR-PLtetO-1; mCherry-PtorCAD129; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRB133.2
Plasmid#181950PurposeaTc-inducible expression of PhoP with C-terminal mNeonGreen fusion. Also contains mCherry under PhoP-controlled promoter PvirKDepositorInsertPhoP-Salmonella enterica subsp. enterica serovar Typhimurium (AX04_RS23485 Synthetic, PhoP-Salmonella enterica subsp. enterica serovar Typhimurium)
TagsmNeonGreenExpressionBacterialPromoterPhoP-mNG-PLtetO-1; mCherry-PvirK; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPbuCas13b-gRNA-1
Plasmid#184567PurposeConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for PbuCas13b in bacteria.DepositorInsertConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for PbuCas13b in bacteria.
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSBK.136
Plasmid#187220PurposeExpresses Eco1 ncRNA v35 (long a1/a2) and Eco1 ncRNA v35 (long a1/a2, barcode 6) from promoters pSalTTC and pTet*, respectivelyDepositorInsertRetron Eco1 ncRNA v35 (long a1/a2); Retron Eco1 ncRNA v35 (long a1/a2, barcode 6)
ExpressionBacterialPromoterA: pSalTTC; B: pTet*Available SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::B1-NLSLacZ-B2
Plasmid#186413PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined NLSLacZ under control of an AttB3/B5 recombined reg. sequence.DepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only