We narrowed to 5,387 results for: mag
-
Plasmid#234670Purposeencodes Cas1:Dendra2Hfx fusion in Haloferax volcanii under the tryptophan inducible p.tna promoter, trpA, ampR, shuttle vector for E.coliDepositorInsertCas1
UseArcheal expression in haloferax volcaniiTagsDendra2HfxPromoterp.tnaAvailable SinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUE001-FtsZ1:Dendra2Hfx
Plasmid#234671Purposeencodes FtsZ1:Dendra2Hfx fusion in Haloferax volcanii under the tryptophan inducible p.tna promoter, trpA, ampR, shuttle vector for E.coliDepositorInsertFtsZ1
UseArcheal expression in haloferax volcaniiTagsDendra2HfxPromoterp.tnaAvailable SinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based no force control)
Plasmid#118718PurposeThe donor (YPet(short)) only control for the no force control of the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-F40-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based tension sensor)
Plasmid#118723PurposeThe donor only (YPet(short)) control for the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-FL-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationinserted FL-based tension sensor module after aa1…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZ_P-ICL1-LacI-Mit1AD
Plasmid#126721PurposeLacI-Mit1AD on pPICZ B expression vectorDepositorInserthybrid lacI-Mit1 activation domain coding sequence
ExpressionYeastPromoterICL1Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPe-IFNAR1(28-557)
Plasmid#192785PurposeExpression of SNAPf and mXFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPeExpressionMammalianMutationmXFPe: tyrosine 66 to phenylalanine, asparagine 1…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH004_phiC31_neo-HS4-5xTetO-pEF-H2B-mCitrine-HS4-pRSV-H2B-mCherry
Plasmid#179432PurposeDual fluorescent reporter construct with double HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertHS4-TRE-cit-HS4-mch (DH)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH003_phiC31_neo-5xTetO-pEF-H2B-mCitrine-coreHS4-pRSV-H2B-mCherry
Plasmid#179431PurposeDual fluorescent reporter construct with single core HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-coreHS4-mch (SC)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based tension sensor)
Plasmid#118717PurposeThe donor (YPet(short)) only control for the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-F40-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pK_P-GAP-LM_lacO-cP-AOX1-sAR
Plasmid#126745Purposeyeast plasmid overexpressing sLovA,CPR and LacI-Mit1ADDepositorInsertslovA,cpr
Tags6xHisExpressionYeastPromoterGAPAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pK_P-ICL1-LM_lacO-cP-AOX1-sAR
Plasmid#126744Purposeyeast plasmid overexpressing sLovA,CPR and LacI-Mit1ADDepositorInsertslovA,cpr
Tags6xHisExpressionYeastPromoterICL1Available SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBEST-p70a-UTR1-Nterm 6xHis PL K16TAG-T500
Plasmid#92315PurposeExpression of NTerm 6xHis tagged protein L (PL) mutant K16TAG for ncAA incoporation using the p70a promoter and UTR1DepositorInsertB1 domain of protein L (PL) mutant K16TAG
UseSynthetic Biology; Cell free protein synthesis (c…Tags6xHisExpressionBacterialPromoterp70b (p70a promoter with one mutation)Available SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV CaMKII:RiboL1-jGCaMP8m (AAV8)
Viral Prep#239668-AAV8PurposeReady-to-use AAV8 particles produced from pAAV CaMKII:RiboL1-jGCaMP8m (#239668). In addition to the viral particles, you will also receive purified pAAV CaMKII:RiboL1-jGCaMP8m plasmid DNA. Neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8m under the CaMKII promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3 (AAV9)
Viral Prep#112007-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3 (#112007). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3 plasmid DNA. hSyn-driven expression of calcium sensor GCaMP6s and bicistronic mRuby3. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmRuby3Available SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-NES-SomaFRCaMPi (AAV8)
Viral Prep#232837-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Syn-NES-SomaFRCaMPi (#232837). In addition to the viral particles, you will also receive purified pAAV-Syn-NES-SomaFRCaMPi plasmid DNA. Synapsin-driven SomaFRCaMPi calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-Ribo-jGCaMP8m (AAV1)
Viral Prep#167574-AAV1PurposeReady-to-use AAV1 particles produced from AAV-hSyn-Ribo-jGCaMP8m (#167574). In addition to the viral particles, you will also receive purified AAV-hSyn-Ribo-jGCaMP8m plasmid DNA. Synapsin-driven neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-Ribo-jGCaMP8s (AAV1)
Viral Prep#167572-AAV1PurposeReady-to-use AAV1 particles produced from AAV-hSyn-Ribo-jGCaMP8s (#167572). In addition to the viral particles, you will also receive purified AAV-hSyn-Ribo-jGCaMP8s plasmid DNA. Synapsin-driven neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8s. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKS_3HA_BSR
Plasmid#122567PurposeVector for endogenously tagging Giardia genes with a triple HA tag (Blasticidin selection)DepositorTypeEmpty backboneTags3x hemagglutinin tagAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only