We narrowed to 23,147 results for: Cas9
-
Plasmid#103113PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertH1DEI0(Cas9 coding gene from Odoribacter laneus YIT 12061)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
G1397 DddAtox-C–SaKKH-Cas9(D10A)
Plasmid#157840Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertG1397 DddAtox-C–SaKKH-Cas9(D10A)–UGI–SV40 NLS
UseCRISPRAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
px459-sgPNPLA3
Plasmid#255036PurposeUsed to generate PLNPLA3 knockout; targets Exon 3DepositorInsertCRISPR Cas9 guide for PNPLA3 exon 3
UseCRISPRExpressionMammalianPromoterU6Available sinceJune 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH333-1-Tier1-PhCMV-dCas9-3xNLS-VP64
Plasmid#169597PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).DepositorInsertdead S.pyogenes Cas9 - VP64 fusion
ExpressionMammalianPromoterPhCMVAvailable sinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGG438
Plasmid#165486PurposeVector for expression of the SpCas9 VRKG variant in human cells: CMV-T7-humanVRKG(SpCas9, D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFLAGDepositorInsertMammalian codon-optimized Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFlag
UseCRISPRTags3x FLAG and SV40 NLSExpressionMammalianMutationD1135V, S1136R, D1332K, and R1333G mutations in S…PromoterCMV and T7Available sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2815 pPB: CAG-Puro-WPRE PGK-KRAB-tagBFP-SpdCas9
Plasmid#84245PurposeExpresses direct fusion KRAB-Sp dCas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsKRAB-tagBFP-Sp dCas9
Puro
UseCRISPR and Synthetic Biology; PiggybacTags2xNLS (SV40), HA tag, KRAB, and tagBFPExpressionMammalianPromoterCAG and PGKAvailable sinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLPB2B-FKBP12_F36V-SpdCas9-KRAB-tagBFP-PGK-Blasticidin
Plasmid#187953PurposeFKBP12 (F36V mutant) degron-tagged dCas9-KRAB domain fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFKBP12_F36V-SpdCas9-KRAB-tagBFP
UseCRISPR and Synthetic BiologyTagsGGSExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSA097 HNRNPK_IVS3-Cas9-BFP
Plasmid#249147PurposeOverexpression of SpCas9-BFP with HNRNPK IVS3 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHNRNPK_IVS3-Cas9-TagBFP (HNRNPK S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHNRNPK IVS3 intronPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC19-B2KB46
Plasmid#103086PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB2KB46(Cas9 coding gene from Elusimicrobium minutum (strain Pei191))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceMay 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-K0XCK7
Plasmid#103118PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertK0XCK7(Cas9 coding gene from Barnesiella intestinihominis YIT 11860)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-H1DEI0
Plasmid#103113PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertH1DEI0(Cas9 coding gene from Odoribacter laneus YIT 12061)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJCKan
Plasmid#185862PurposeThe CRISPR/Cas9-and-gRNA-expressing plasmid with a G418-resistent selectable markerDepositorInsertPTDH3-Cas9(N); PSNR52-srRNA-TSUP4; KanMX4
ExpressionYeastMutationNoneAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-KRAB(Kox1)-MeCP2-P2A-EGFP
Plasmid#188902PurposedCas9 with a C-term NLS-KRAB(Kox1)-MeCP2 fusion (no linker), and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertdCas9-KRAB(Kox1)-MeCP2
UseLentiviralTagsNLS-KRAB(Kox1)-MeCP2 fusion (no linker) and P2A-G…PromoterSFFVAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax-SpG
Plasmid#195278PurposeAllows for in vitro transcription of original pCMV-T7-ABEmax(7.10)-SpG-P2A-EGFP (RTW4562) without EGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpG without EGFP
ExpressionMammalianPromoterCMVAvailable sinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TK4_Zim3-dCas9-2xMyc-NLS-T2A-mApple_EF1a-Hygro
Plasmid#254456PurposeTK4 PiggyBac plasmid for stable expression of Zim3-dCas9 during human pluripotent stem cell differentiationDepositorInsertsZim3-dCas9-2xMyc-NLS-T2A-mApple
hygroR
UsePiggybacTagsT2A-mAppleExpressionMammalianPromoterCAG and EF1aAvailable sinceApril 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
GS2.1/EC
Plasmid#132568PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).DepositorInsertegg cell promoter, Cas9-mApple, pds3 sgRNA
UseCRISPR and Synthetic BiologyExpressionPlantPromoterA. thaliana egg cell promoterAvailable sinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-G9QLF2
Plasmid#103111PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertG9QLF2(Cas9 coding gene from Bacillus smithii 7_3_47FAA)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-J9E534
Plasmid#103078PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertJ9E534(Cas9 coding gene from Alicyclobacillus hesperidum URH17-3-68)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-B1UZL4
Plasmid#103085PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB1UZL4(Cas9 coding gene from Clostridium perfringens D str. JGS1721)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only