We narrowed to 7,512 results for: mcherry
-
Plasmid#215139PurposeExpresses mCherry-POLD1 in mammalian cells from a retroviral vector.DepositorAvailable sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pmCherry-N1-cofilin
Plasmid#186750PurposeExpresses wildtype mCherry-tagged human cofilin in mammalian cellsDepositorAvailable sinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 947 (pME-mmTcf4_DN_P2A_mCherry)
Plasmid#232122PurposeA middle entry gateway clone containing myc-tagged murine dominant negative Tcf4 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorPublicationAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1-GW yomCherry-T2A-mTurquoise2
Plasmid#118447PurposeProduces equimolar expression of yeast codon-optimized mCherry and mTq2DepositorInsertyomCherry-T2A-mTurquoise2
ExpressionYeastAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA-SV40-mCherry
Plasmid#240538PurposeLentiviral backbone plasmid to insert epegRNAs (tevopreq1) of interest with mCherry. The cloning site is BsmBI.DepositorInsertepegRNA
UseCRISPR and LentiviralExpressionMammalianAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-Hyg-Dest-mCherry-PAR-6B
Plasmid#194908PurposeTo generate mCherry-PAR-6B (mouse) expressing stable cell lines with piggybac transposase co-expression and hygromycin selections.DepositorInsertPAR-6B (Pard6b Mouse)
UseMouse TargetingTagsmCherryExpressionMammalianMutation39 C to G, silent mutationAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLEX-NEUROD1-T2A-mCherry
Plasmid#178584PurposeCre-dependent expression of NEUROD1 and mCherry under the constitutive promoterDepositorAvailable sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-mCherry-p2A-LIC1 C-terminal half
Plasmid#74603Purposeexpresses LIC1 in mammalian cells; aa 389-523, untagged but cells indicate expression with diffuse mCherryDepositorInsertfull length human dynein light intermediate chain 1 amino acids 389-523 (DYNC1LI1 Human)
UseLentiviralTagsHA tagExpressionMammalianMutationamino acids 389-523 of LIC1PromoterSFFVAvailable sinceMay 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
P-Ef1a-RPL22-3XHA-P2A-mCherry-T2A-Neo
Plasmid#170321PurposeExpresses HA and mCherry tagged RPL22, neomycin resistanceDepositorAvailable sinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
(pRZ115) AAV: U6-gRNA-EF1a-mCherry
Plasmid#254584PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and mCherry from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-puro_UCOE_TRE3VG_mCherry-Responder
Plasmid#230053PurposeIt presents the UCOE sequence and the TRE3VG inducible promoter allowing a more stable dox-dependent inducible activation of mCherry though the OPTi-OX platform across differentiation of hiPSCsDepositorInsertUCOE
ExpressionMammalianPromoterTRE3VGAvailable sinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pN1-mCherry-NKD2
Plasmid#176641PurposeExpresses NKD2-mCherry fusion protein in mammalian cellsDepositorInsertHomo sapiens NKD inhibitor of WNT signaling pathway 2 (NKD2 Human)
TagsmCherry tagExpressionMammalianPromoterCMVAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CBX1wt-PA-mCherry
Plasmid#138252PurposeWild-type CBX1 chromodomain (residues 20-73) tagged with photoactivatable mCherry (PAmCherry).DepositorInsertCBX1-PAmCherry
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable sinceJuly 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCherry-hPMCA2xb
Plasmid#47751Purposemammalian expression of mCherry tagged hPMCA2, xb splice variantDepositorInsertPMCA2x/b (ATP2B2 Human)
TagsmCherryExpressionMammalianMutationxb splice variantPromoterCMVAvailable sinceNov. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDO001
Plasmid#198828PurposeInhibition of synaptic vessel release due to disruption of synaptic vessel function by reactive oxygen species production.DepositorInsert15xUAS::miniSOG-103L-VAMP2-mCherry::let-858 3'UTR
ExpressionWormAvailable sinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1653_sgSOD1
Plasmid#63711PurposeExpress sgSOD1 in mammalian cells of human.DepositorPublicationInsertsgSOD1, CAG promoter, mCherry, puro
ExpressionMammalianAvailable sinceApril 27, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSBbi-FoxO1_1R_13A_3D
Plasmid#106279PurposeFluorescent fusion protein for FoxO1DepositorInsertsTagsClover fluorescent protein and NLSExpressionMammalianMutationDeleted amino acids 401-636, T24A, S209A, H212R, …PromoterEF1a/RPBSAAvailable sinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW8_mCherry
Plasmid#110238PurposeCre/Lox C-terminal tagging construct encoding red fluorescent protein mCherryDepositorPublicationTypeEmpty backboneUseCre/LoxAvailable sinceApril 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MBP-ULK1-1-835-mcherry
Plasmid#249729PurposeExpressing human ULK1-1-835 with a MBP tag in N-terminal and a mcherry tag in C-terminalDepositorAvailable sinceMarch 27, 2026AvailabilityAcademic Institutions and Nonprofits only