We narrowed to 6,787 results for: PROC
-
Plasmid#127264PurposeFor in vitro translation of human ELL2 with Met133ILeu, Met186ILeuDepositorInsertELL2 (Met133ILeu, Met186ILeu) (ELL2 Human)
UseIn vitro translationMutationTwo Mets (133,186 )to ILeu QuikchangePromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
Met331Leu ELL2
Plasmid#127262PurposeFor in vitro translation of human ELL2 with Met331 mutated to Ileu to ask if there is internal initiationDepositorInsertELL2 (Met331 to Ileu) (ELL2 Human)
UseIn vitro translationMutationMet331 to ILeu QuikchangePromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
COOHend ELL2
Plasmid#127255PurposeExpresses the C terminal segment of human ELL2 in mammalian cellsDepositorInsertELL2 (C-terminal end) (ELL2 Human)
UseOtherExpressionMammalianMutationcontains only the last 389 aaPromoterpEF1aAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
Met1ILeu ELL2
Plasmid#127258PurposeFor in vitro translation of human ELL2 with Met1 mutated to Ileu to ask if there is internal initiationDepositorInsertELL2 (Met1 to Ileu) (ELL2 Human)
UseIn vitro translationMutationMet1 to Ileu by QuikchangePromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
ELL2mRNA+polyA
Plasmid#127256PurposeFor in vitro translation of human ELL2 with 30 nt pA tailDepositorInsertELL2 (ELL2 Human)
UseIn vitro translationMutationshortens 3'UTR to 40 bp adds A30 tailPromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
NH2end ELL2
Plasmid#127252PurposeExpresses the N terminal segment of human ELL2 in mammalian cellsDepositorInsertELL2 (1-287) (ELL2 Human)
UseOtherTagsHis6XExpressionMammalianMutationcontains only amino acids 1-289PromoterpEF1aAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Xba ELL2
Plasmid#127268PurposeFor in vitro translation of WT ELL2 with HA tag inserted near N-termDepositorInsertELL2 (ELL2 Human)
UseIn vitro translationMutationELL2mRNA+polyA with HA tag inserted at aa12 betwe…PromoterT7Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 GABARAPL1 no-stop
Plasmid#123210PurposeGateway entry clone encoding human GABARAPL1 lacking stop codon, suitable for C-terminal taggingDepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseGateway entry vector / entry cloneMutationStop codon removedAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 GABARAPL2 no-stop
Plasmid#123211PurposeGateway entry clone encoding human GABARAPL2 lacking stop codon, suitable for C-terminal taggingDepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
UseGateway entry vector / entry cloneMutationStop codon removedAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter mir16-1.3
Plasmid#46682PurposeExpresses a mutant version of the wild-type miR-16-1 in mammalian cellsDepositorInsertmir16-1.3 (MIR16-1 Synthetic, Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianMutationsee sequence and publicationPromoterCMVAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter mir16-1.1
Plasmid#46680PurposeExpresses a mutant version of the wild-type miR-16-1 in mammalian cellsDepositorInsertmir16-1.1 (MIR16-1 Synthetic, Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianMutationsee sequence and publicationPromoterCMVAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
HOXB6-WG-MSCV
Plasmid#20993DepositorInsertHOXB6 (HOXB6 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationW->G mutation in YPWM interaction motif for PB…Available SinceAug. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLX313-Firefly luciferase
Plasmid#118017PurposeConstitutive expression of Firefly luciferaseDepositorInsertFirefly luciferase
UseLentiviralExpressionMammalianPromoterEF1alphaAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX313-Renilla luciferase
Plasmid#118016PurposeConstitutive expression of Renilla luciferaseDepositorInsertRenilla luciferase
UseLentiviralExpressionMammalianPromoterEF1alphaAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOG44_FLP_recombinase (pEHA1338)
Plasmid#209087PurposeFLP recombinase for FRT-mediated integrationDepositorInsertFLP recombinase
ExpressionMammalianPromoterCMVAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(C128S/D156A)-mCherry
Plasmid#35504PurposeAAV expression of Ef1a-driven, cre-dependent, stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2(C128S/D156A)-mCherry
UseAAVTagsmCherryExpressionMammalianMutationC128S and D156APromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO (pEHA1339)
Plasmid#209088PurposeBackbone plasmid for Tet Responsive transgene expression, FRT integrationDepositorTypeEmpty backboneExpressionMammalianAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX311-Cas9
Plasmid#118018PurposeConstitutive expression of Cas9DepositorInsertCas9
UseLentiviralExpressionMammalianPromoterEF1alphaAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Kir2.1WT-2A-mScarlet-KASH
Plasmid#203840PurposeKir2.1 expression for silencing neurons and mScarlet-KASH expressionDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV 3xFLAG-LC3B-GFP
Plasmid#123107PurposeExpresses 3xFLAG-LC3B-EGFP in mammalian cells, for monitoring ATG4 activity towards LC3BDepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
Tags3xFLAG and EGFPExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N-Drd1
Plasmid#104358PurposeExpresses mouse dopamine receptor subtype 1 with EGFP fused to the C-terminus of the receptor. Localizes to primary cilia.DepositorAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(C128S/D156A)-EYFP
Plasmid#35503PurposeAAV expression of Ef1a-driven, cre-dependent, stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2(C128S/D156A)-EYFP
UseAAVTagsEYFPExpressionMammalianMutationC128S and D156APromoterEf1aAvailable SinceApril 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn LAMP1-msGFP (JV012)
Plasmid#179728PurposeLentiviral expression of LAMP1-msGFP for use as a lysosomal markerDepositorInsertLAMP1 (Lamp1 Mouse)
UseLentiviralAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pExodus CMV.Artemis
Plasmid#40211PurposeMammalian expression of codon-optimized Artemis.DepositorAvailable SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry
Plasmid#35498PurposeAAV expression of Ef1a-driven, cre-dependent, chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.DepositorInsertChR1-VChR1 Chimera
UseAAVTagsmCherryExpressionMammalianMutationE122T and E162TPromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-C1V1 (t/t)-TS-EYFP
Plasmid#35499PurposeAAV expression of CaMKII-driven chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.DepositorHas ServiceAAV9InsertChR1-VChR1 Chimera
UseAAVTagsEYFPExpressionMammalianMutationE122T and E162TPromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFP
Plasmid#35497PurposeAAV expression of Ef1a-driven, cre-dependent, chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.DepositorHas ServiceAAV9InsertChR1-VChR1 Chimera
UseAAVTagsEYFPExpressionMammalianMutationE122T and E162TPromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-LC3B G120A
Plasmid#123115PurposeExpresses EGFP-LC3B G120A in mammalian cells. Negative control fluorescent reporter, unable to localize to autophagosomes.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFPExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLOD2-bio-His
Plasmid#51756PurposeExpresses full-length Procollagen-lysine,2-oxoglutarate 5-dioxygenase 2 ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertPLOD2 (PLOD2 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only