We narrowed to 21,344 results for: Cre
-
Plasmid#127965PurposesgRNA expression vector compatible with CROP-Seq and imaging screensDepositorInsertEF1a-Puro-T2A-2xmycNLS-WPRE-mU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceAug. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMS_375
Plasmid#182132Purposeexpresses retron RNA, ec.86 Reverse Transcriptase, CspRecT SSAP, and mutL* to create a specific rifampicin resistance mutation while inhibiting MMRDepositorInsertsretron RNA
ec.86 RT
CspRecT
Mutationincorporated rifampicin-resistance-conferring don…Available SinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
PET-HiFi SpCas9-NLS-6xHis
Plasmid#207376PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertHiFi SpCas9
UseCRISPRTags6xHisExpressionBacterialMutationR691APromoterT7Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-StAR4B (Lenti)
Plasmid#222691PurposeCRISPR-screeningDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianMutationPGK without BsmBI cutsiteAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMax_mOrange_G299C
Plasmid#177829PurposeSite-specific mutagenesis of mOrange for the purposes of creating a site-specific G:G mispair for the purposes of measuring MMR activity via Host Cell Reactivation (HCR).DepositorInsertmOrange_G299C
ExpressionMammalianMutationG299CPromoterCMVAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
All_in_one_CRISPR/Cas9_LacZ
Plasmid#74293Purpose"All-in-one" CRISPR/Cas9 (wt) plasmid for cloning of custom gRNA with blue/white screeningDepositorInsertsLacZ-alpha
Cas9
mCherry
UseCRISPRTagsHAExpressionBacterial and MammalianPromoterLac promoter, SV40, and T7 promoterAvailable SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
AgDD
Plasmid#78289Purposecreate protein aggregates in living cellsDepositorAvailable SinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
CRISPseq-BFP-backbone
Plasmid#85707PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with a BFP fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PET-eSpCas9-NLS-6xHis
Plasmid#207379PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInserteSpCas9
UseCRISPRTags6xHisExpressionBacterialMutationK848A, K1003A, R1060APromoterT7Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMax_mOrange_A215C
Plasmid#177828PurposeSite-specific mutagenesis of mOrange for the purposes of creating a site-specific 8-oxo-G:C lesion for the purposes of measuring OGG1 activity via Host Cell Reactivation (HCR).DepositorInsertmOrange_A215C
ExpressionMammalianMutationA215CPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMax_GFP_C289T
Plasmid#177826PurposeSite-specific mutagenesis of GFP for the purposes of creating a site-specific hypoxanthine lesion for the purposes of measuring MPG activity via Host Cell Reactivation (HCR).DepositorInsertGFP_C289T
ExpressionMammalianMutationC289TPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
NLS-AgDD
Plasmid#80625Purposecreate nuclear protein aggregates in mammalian cellsDepositorAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCPP3373
Plasmid#128718PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopQ1-1
ExpressionBacterialMutationSynonymous point mutation in the wobble position…Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-gst-xr
Plasmid#214761PurposeXylose reductase from Hypocrea jecorina fused with GST-tagged and codon optimized for expression in E. coliDepositorInsertglutathione S-transferases fused with xylose reductase
TagsGlutathione S-transferasesExpressionBacterialPromoterT7Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMax_BFP_A191G
Plasmid#177823PurposeSite-specific mutagenesis of tagBFP for the purposes of creating a site-specific U:A mispair for the purposes of measuring UDG activity via Host Cell Reactivation (HCR).DepositorInserttagBFP_A191G
ExpressionMammalianMutationA191GPromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPseq-mCherry-backbone
Plasmid#85708PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with an mCherry fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPReporter-mCherry
Plasmid#65008PurposeE. coli reporter vector with MCS for inserting bacterial promoter region through 5' end of gene of interest, upstream and in-frame with mCherry reporter.DepositorInsertmCherry
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterUser-definedAvailable SinceMay 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
PBMN YFP-ER50
Plasmid#37261DepositorInsertER50 (ESR1 Human)
UseRetroviralTagsHA-YFPMutation6 mutations, T371A, L384M, M421G, G521R, Y537S, N…PromoterLTRAvailable SinceAug. 7, 2012AvailabilityAcademic Institutions and Nonprofits only