We narrowed to 17,189 results for: AGA
-
Plasmid#128510PurposeLentiviral constitutive expression of CRISPR-resistant PINK1 with c-terminal FLAG and HA tag.DepositorInsertPTEN induced kinase 1 (PINK1 Human)
UseLentiviralTagsFLAG and HA tagsExpressionMammalianMutationSynonymous silent mutation in Q5 to render sgRNA …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Zinc Finger Consortium OPEN Accessory Reagent Set
Plasmid Kit#1000000013PurposePlasmids and strains used to engineer ZFNs via the Oligomerized Pool ENgineering (OPEN) method.DepositorApplicationGenome EditingVector TypeBacterial Expression, Insect Expression, Mammalian Expression, Plant ExpressionEditing TypeZFNAvailable SinceJuly 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
hNTo2-qgRNA-pYJA5
Plasmid#217782PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCX-TRI-2A
Plasmid#74674Purposemammalian expression of TRI-2A (hHO1/F2A/hCD73/F2A/hCD39)DepositorTagsF2AExpressionMammalianPromoterpCAGGSAvailable SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTBL1269 pLenti-CHYRON17-pEF1a(short)-Luc2-P2A-tdTomato-T2A-TdT
Plasmid#163643PurposeMakes a lentivirus that expresses hgRNA with 17nt spacer and Luc2, tdTomato, and human TdT.DepositorInsertsUseLentiviralTagsLuc2-P2A-tdTomato-T2AMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterEFS and pU6Available SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-1 in pcDNAI/Amp
Plasmid#54468PurposeAn amino-terminal YFP fragment was fused to Gbeta-1. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP (1-158)/beta-1 (GNB1 Human, Aequorea victoria)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-1 was amplified via PCR, which removed an i…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWZL Sox2
Plasmid#26351DepositorAvailable SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B
Plasmid#133308PurposeExpression of luciferase driven by eIF3B promoter regionDepositorAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE FoxE1
Plasmid#26350DepositorAvailable SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-2 in pcDNAI/Amp
Plasmid#54469PurposeAn amino-terminal YFP fragment was fused to Gbeta-2. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-2 (GNB2 Human, Aequorea victoria)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-5 in pcDNAI/Amp
Plasmid#54470PurposeAn amino-terminal YFP fragment was fused to Gbeta-5. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-5 (GNB5 Human, Aequorea victoria)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…Available SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only