We narrowed to 4,644 results for: pes
-
Plasmid#192378PurposeTo test if the TCTP promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9339 (pgRNA_VII-1_NatMX)
Plasmid#161591PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site VII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9340 (pgRNA_VIII-1_NatMX)
Plasmid#161592PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site VIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9342 (pgRNA_XIII-1_NatMX)
Plasmid#161594PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9344 (pgRNA_XVI-1_NatMX)
Plasmid#161596PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XVI-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW927
Plasmid#115961PurposeORF insert for replicon MoCloDepositorInsertLvl0 ORF TetR-2A-mKate-PEST GG
UseSynthetic BiologyAvailable SinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
OpenLoopControl
Plasmid#59895Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Does not contain the target containing Vamp3 3′UTRDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPESTExpressionMammalianPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
CMV-LUC2CP/ARE
Plasmid#62857PurposeSplicing reporter control (no intron) with elements to shorten the half-life of the luciferase protein as well as the luciferase mRNA.DepositorInsertLuciferase
UseLuciferaseExpressionMammalianMutationdestabilizing sequences (DS) added to the C termi…PromoterCMVAvailable SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
6xHsa.NFKB:d2mRFP1
Plasmid#239991PurposeDestabilized red fluorescent protein (d2mRFP1) under transcriptional control of NF-kB activationDepositorInsertsmRFP1
PEST
Promotercfos minimal promoterAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-1
Plasmid#121533PurposesgITGB1-1 sequence: GAAGCAGGGCCAAATTGTGGG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
p5179
Plasmid#239358PurposeExrpession of Rice TIR1 F74->G, Rice ARF fragment and blaticidin resistance by read through transaction after integration int the PFR1 locusDepositorInsertRice TIR1, Rice ARF16 and blasticidin resistance
UseBacterialTagsTIR1 and ARF are both Ty-epitope taggedMutationTIR1 F74->G. ARF16 is residues 784 to 959 onlyPromoternoneAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVhPOP1_3Flag
Plasmid#53968PurposeMammalian expression vector for human POP1 with c-terminal 3xFLAG epitopes.DepositorAvailable SinceJuly 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMX IkB alpha M
Plasmid#12329DepositorInsertIkB alpha M (Nfkbia Mouse)
ExpressionMammalianMutationDominant-negative mutant. Many signal transductio…Available SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-NLS-CBRed-d2-hygro
Plasmid#139196Purposenon-ERK dependent control plasmid for pMSCV-NLS-CBGreen-FIRE-puroDepositorInsertCBRed
UseLuciferase and RetroviralTagsd2 PEST domain and nuclear localization signal (N…ExpressionMammalianAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
Fireworks RFP[PTC-] (AVA2515)
Plasmid#85443PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xtdTomato-TEVprotease-PEST-beta-globin(dI1)-BGH polyA tDNA2 FRT-HygromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLXSN IkB alpha M
Plasmid#12330DepositorInsertIkB alpha M (Nfkbia Mouse)
UseRetroviralExpressionMammalianMutationDominant-negative mutant. Many signal transductio…Available SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pJW1836
Plasmid#154337PurposePromoter reporterDepositorInsertSV40 NLS::mScarlet_I::PEST (dpi)::-tbb-2 3'UTR
ExpressionWormMutationSilent mutations to remove piRNA sitesAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCfB3052(gRNA X-4, XI-3, XII-5)
Plasmid#73294PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-4, XI-3, and XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-AD8-QES.i08.c04
Plasmid#123259PurposeMammalian expression plasmid for Env from the AD8 HIV-1 isolate; QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (AD8) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Mutations P124D, …PromoterCMVAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only