We narrowed to 30,307 results for: ple
-
Plasmid#209761PurposeAAV virus production for neuonal expression of uMASS (loss-of-function) under hSyn promoterDepositorInsertuMASS_LF
UseAAVExpressionMammalianAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pS44i8GH-1
Plasmid#207525PurposeConditionally-replicating in Pseudomonas vector, high-copy-number; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP; SmR/SpRDepositorInsertoriV(pRO1600/ColE1), xylS, Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP;
UseCRISPR; Pseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-dMASS_LF_WPRE
Plasmid#209766PurposeAAV virus production for neuronal expression of dMASS_LF (loss-of-function) under hSyn promoterDepositorInsertdMASS_LF
UseAAVExpressionMammalianPromoterhSynAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_HA-Flag-uMASS_1_WPRE
Plasmid#209760PurposeAAV virus production for neuronal expression of uMASS_1 under hSyn promoterDepositorInsertuMASS_1
UseAAVExpressionMammalianAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-RanGAP*
Plasmid#175237PurposeBacterial expression and purification, low affinity SUMOylation substrate, point mutation F562A reduces affinity for E2, increasing the KmDepositorAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-E2
Plasmid#175243PurposeBacterial expression and purification, E2 enzyme (UBC9) for SUMOylation, can be recruited to FRB with rapamycin, CyPet acts as a FRET donor to YpetDepositorAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
FKBP-EGFP-RanGAP
Plasmid#175236PurposeBacterial expression and purification, high affinity SUMOylation substrate that can recruited to FRB with rapamycinDepositorAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-V9
Plasmid#173797PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene noctiflora ClpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V7
Plasmid#173796PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene latifolia clpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V6
Plasmid#173795PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene conica clpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V4
Plasmid#173794PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Nicotiana tabacum clpP1 gene with native regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pG418R-MCS-LexA-VP16-MiniWhite
Plasmid#165894PurposeG418 resistant LexA driver vector with Mini-w+ CDS eye marker. Enhancer grammar GB20 entry point for custom enhancers. Cut-and-paste cloning can be used. Purple-white bacteria colony screening.DepositorInsertSelectable Empty Enhancer Driver
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS2267
Plasmid#158392PurposeHigh Copy number plasmid containing Ple341 (PCP2 MiniPromoter) insertDepositorAvailable SinceFeb. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS2279
Plasmid#158399PurposeHigh Copy number plasmid containing Ple349 (PDE6H MiniPromoter) insertDepositorAvailable SinceFeb. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKD284
Plasmid#125073PurposeExpression of SO_4488 under PtacDepositorUseSynthetic BiologyExpressionBacterialAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKD278
Plasmid#125070PurposeExpression of SO_2192 under PtacDepositorUseSynthetic BiologyExpressionBacterialMutationMutation in LacI S286L- Please see depositor comm…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Opto-GPR148
Plasmid#106048PurposeExpression of a chimeric G-protein coupled receptor (Rhodopsin-GPR148; Opto-GPR148; E2)DepositorInsertOpto-GPR148 (GPR148 Human, Bovine)
TagsRhodopsin-1D4 and VSV-GExpressionMammalianMutationChimeric receptor proteinPromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
Opto-GPR78
Plasmid#106033PurposeExpression of a chimeric G-protein coupled receptor (Rhodopsin-GPR78; Opto-GPR78; C11)DepositorInsertOpto-GPR78 (GPR78 Human, Bovine)
TagsRhodopsin-1D4 and VSV-GExpressionMammalianMutationChimeric receptor proteinPromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
Opto-GPR42
Plasmid#106022PurposeExpression of a chimeric G-protein coupled receptor (Rhodopsin-GPR42; Opto-GPR42; B12)DepositorInsertOpto-GPR42 (GPR42 Human, Bovine)
TagsRhodopsin-1D4 and VSV-GExpressionMammalianMutationChimeric receptor proteinPromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only