We narrowed to 13,838 results for: CRISPR-Cas9
-
Plasmid#179916PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV51
Plasmid#179915PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 51.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV162
Plasmid#179917PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 162.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern332
Plasmid#179914PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern fluorescent protein site 332.DepositorInsertmGreenLantern sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP1830
Plasmid#70708PurposeHuman expression plasmid for SaCas9 KKH variant: CAG-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAGDepositorInsertmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
UseCRISPRTagsNLS-3xFLAGExpressionMammalianMutationE782K, N968K and R1015H in SaCas9PromoterCAGAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pS648∙CsR
Plasmid#197860PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Gm resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pS548∙CsR
Plasmid#197859PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Tc resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03
Plasmid#71535PurposeUsed to construct a gRNA expression cassette for CRISPR/Cas9 genome editing in Marchantia polymorphaDepositorTypeEmpty backboneUseCRISPRAvailable SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pS848∙CsR
Plasmid#199240PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Gm resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo
Plasmid#80766PurposeCustomizable donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorTypeEmpty backboneUseCRISPRTagsTagBFP2-3×NLSExpressionMammalianAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En01
Plasmid#71534PurposeUsed to construct a gRNA expression cassette for CRISPR/Cas9 genome editing in Marchantia polymorphaDepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSP2283
Plasmid#70702PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2266
Plasmid#70705PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX208
Plasmid#89268PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA01 and OsYSA-gRNA02DepositorInsertOsYSA-gRNA01 and OsYSA-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMKR07
Plasmid#240097PurposeA CRISPR‑Cas9 system for knock‑out and knock‑in of high molecular weight DNA enables module‑swapping of the pikromycin synthase in its native hostDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialPromoterermE* promoterAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEL052
Plasmid#137906PurposeOsBiP1 promoter driven Cas9-tRNA systemDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only