We narrowed to 4,664 results for: crispr c plasmids
-
Plasmid#204673PurposeDual gRNA plasmid for UCK2 deletionDepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pAAV_Donor/Reporter-COL4A3
Plasmid#130279PurposeCOL4A3 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A3 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g3 (BB36)
Plasmid#139454PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g2 (BB35)
Plasmid#139453PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Brunello in lentiCRISPRv2
Pooled Library#73179PurposeHuman sgRNA library in backbone lentiCRISPRv2 targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000 non-targeting controlsDepositorHas ServiceLentiviral PrepExpressionMammalianUseCRISPR and LentiviralAvailable SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
Mouse sgRNA library Brie in lentiCRISPRv2
Pooled Library#73632PurposeMouse sgRNA library in backbone lentiCRISPRv2 containing 78,637 unique sgRNAs targeting 19,674 genes along with 1000 non-targeting controlsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
CMV-CD16-TLR4-HA
Plasmid#246906PurposeExpresses CD16-TLR4 chimera in mammalian cellsDepositorUseLentiviralTagsHAExpressionMammalianMutationN terminus of CD16, C terminus of TLR4PromoterCMVAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(FCA)-6xHis-NLS(SV40)
Plasmid#185701PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(FCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(FCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PDCA)-6xHis-NLS(SV40)
Plasmid#185705PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PDCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PDCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(SCA)-6xHis-NLS(SV40)
Plasmid#185703PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(SCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(SCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PCA)-6xHis-NLS(SV40)
Plasmid#185704PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(BCA)-6xHis-NLS(SV40)
Plasmid#185702PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(BCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(BCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
JI501: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 gRNA scaffold
Plasmid#121841PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; empty hU6-driven SaCas9 gRNA scaffold for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to dCas9 w/ gRNA expressionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KK701: pMAGIC (L3-L2) 3x HA eptitope tag + polyA; hU6::xCas9(3.7) gRNA scaffold
Plasmid#121842PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; empty hU6-driven xCas9(3.7) gRNA scaffold for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA fusion to dCas9 w/ gRNA expressionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cas9_ANKRD1_sgRNA2
Plasmid#186669PurposePlasmid containing Cas9 and ANKRD1 sgRNA2 , sgRNA sequence: cggtcagcttatatagct.DepositorInsertANKRD1 KO sgRNA Plasmid (ANKRD1 Human)
ExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only