We narrowed to 16,171 results for: grna
-
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-TGM2
Plasmid#69239PurposeU6 driven SpCas9 sgRNA expression for TGM2 siteDepositorAvailable sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-scramble
Plasmid#62285Purposeexpression of scramble sgRNA from the arabinose-inducible promoterDepositorInsertscramble sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB3047(gRNA XII-1)
Plasmid#73289PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-1DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
FISSEQ-hgRNA-Design2
Plasmid#100572PurposeFISSEQ-hgRNA-Design2 in a lentiviral backboneDepositorInsertFISSEQ-hgRNA-Design2
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianAvailable sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
Plasmid#68346PurposeUsed to produce AAV expressing the FlpO recombinase and pig gRNA towards 3 tumor suppressors: PTEN, p53 and SMAD4DepositorInserts3xgRNA;PTENA, p53B,SMAD4A
FlPO
UseAAV; Flp/frtExpressionMammalianPromoterCAG and U6Available sinceDec. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
p183_LTJ_sgRNACD90.2_A
Plasmid#82671PurposesgRNA targeting murine CD90.2. Co-expresses SpCas9-2A-EGFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting CD90.2
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
EMX1_sgRNA
Plasmid#100555PurposeExpresses EMX1 sgRNA. Target sequence: GAGTCCGAGCAGAAGAAGAADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEMX1 sgRNA
PromoterU6Available sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE (AAV1)
Viral prep#125712-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE (#125712). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE plasmid DNA. CaMKIIa-driven expression of the optimized mosquito OPN3 rhodopsin in-frame with mScarlet. These AAV preparations are suitable purity for injection into animals.DepositorPromotershort version of αCamKinase II promoter (0.4kb)TagsmScarletAvailable sinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR 2xU6:gRNA pten, mitfa:Cas9
Plasmid#118845PurposeTargets ptena and ptenb and expresses zebrafish mitfa specifically in zebrafish melanocytesDepositorAvailable sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBbE2k-pTet-gRNAwcaF159
Plasmid#122259PurposeaTc inducible gRNA expression plasmidDepositorInsertgRNAwcaF159
UseSynthetic BiologyAvailable sinceMarch 1, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pXJ512-pAAV-PB3'IR-CAG-MCP-mtagBFP-KASH-6XMS2-dual sgRNA-PB5'IR
Plasmid#254952PurposeAAV piggyBac vector with dual gRNAs and CAG-driven MCP-mtagBFP-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertMCP-mtagBFP-KASH
UseAAV and CRISPRExpressionMammalianAvailable sinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pXJ514-pAAV-PB3'IR-CAG-PCP-mScarlet-KASH-6XPP7-dual sgRNA-PB5'IR
Plasmid#254953PurposeAAV piggyBac vector with dual gRNAs and CAG-driven PCP-mScarlet-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertPCP-mScarlet-KASH
UseAAV and CRISPRExpressionMammalianAvailable sinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pXJ515-pAAV-PB3'IR-CAG-PCP-mtagBFP-KASH-6XPP7-dual sgRNA-PB5'IR
Plasmid#254954PurposeAAV piggyBac vector with dual gRNAs and CAG-driven PCP-mtagBFP-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertPCP-mtagBFP-KASH
UseAAV and CRISPRExpressionMammalianAvailable sinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pXJ521-pAAV-PB3'IR-CAG-PCP-GFP-KASH-6XPP7-hU6-gRNA-PB5'IR
Plasmid#254956PurposeAAV piggyBac vector with single gRNA and CAG-driven PCP-sfGFP-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertPCP-sfGFP-KASH
UseAAV and CRISPRExpressionMammalianAvailable sinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_sgRNA
Plasmid#68422PurposeTransient expression of a minimal sgRNA targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorInsertGluc sgRNA
UseCRISPRExpressionMammalianPromoterhuman U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141D-gRNA2.1
Plasmid#167161PurposeExpress single gRNA with gRNA2.1 scaffold (with four MS2 binding sites) under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU3Available sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
1313_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-SACas9-HA-OLLAS-spA
Plasmid#109314PurposePlasmid for liver-specific expression of AAV SaCas9 with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable sinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(12))-PGKpuroBFP-W
Plasmid#208569PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only