We narrowed to 11,308 results for: ENA
-
Plasmid#52171PurposeEncodes module 8 with amino acids 12C-16Q for recognition of nt 1ADepositorInsertPumilio homology domain amino acids 284-319 (PUM1 Human)
ExpressionBacterialMutationChanged 12N to 12C in module 8Available SinceApril 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf196
Plasmid#12884PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf196
ExpressionMammalianAvailable SinceDec. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9 PE2-3HA
Plasmid#169853PurposeMammalian Expression, SpyCas9 prime editor with 3HA-tagDepositorInsertSpCas9-H840A-M-MLV-3HA
Tags3XHA tag and bpSV40 NLSExpressionMammalianPromotercmvAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25G
Plasmid#91144PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf117
Plasmid#12805PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf117
ExpressionMammalianAvailable SinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pETNKI-strepII-3C-LIC-kan
Plasmid#108706PurposeExpression of a StrepII-tagged target protein with 3C protease cleavage site.DepositorTypeEmpty backboneTagsStrepII-3C protease cleavage siteExpressionBacterialPromoterT7Available SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRvCAHS1-mEGFP-NLS
Plasmid#205013PurposeThe vector contains 1kbp of the upstream and downstream regions of the cahs1 gene from Ramazzottius varieornatus, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the cahs1 gene from Ramazzottius varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRvSAHS1-mCherry-NLS
Plasmid#205009PurposeThe vector contains 1kbp of the upstream and downstream regions of the sahs1 gene from Ramazzottius varieornatus, with the mCherry gene with NLS sequence positioned in between.DepositorInsertmCherry-NLS flanked by 1kbp upstream and downstream of the sahs1 gene from R. varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha1 clone2
Plasmid#162120PurposeLentiviral sgRNA plasmid targeting human AMPK alpha1DepositorInsertsgAMPK alpha1 (PRKAA1 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL7.0-iRFP670-micro
Plasmid#135954PurposeExpresses an iLID micro (SspB R73Q)-iRFP670 fusion in mammalian cells.DepositorInsertiLID micro (SspB R73Q)
UseLentiviralTagsiRFP670ExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
BRD4 CRISPRi plasmid
Plasmid#154890PurposeHuman BRD4 CRISPRi gRNADepositorInsertBRD4-targeting gRNA
UseCRISPR and LentiviralAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25I
Plasmid#91146PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1010m (RFP)_CD
Plasmid#66033PurposeMoClo Basic Part: CDS - Fluorescent protein. Red. Modified from Bba_E1010 to fix illegal sites. [C:E1010m:D]DepositorInsertFluorescent reporter - RFP
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_GSK3B
Plasmid#111687PurposeMAC-tagged gene expressionDepositorInsertGSK3B (GSK3B Human)
ExpressionMammalianAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDsRed2-C1-Ahi1
Plasmid#30495DepositorAvailable SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMS6: pHelper(AvCAST)_entry_ΔTnsD
Plasmid#168139PurposeInducible expression of AvCAST proteins (except TnsD). Two BsaI sites for spacer cloning.DepositorInsertsAvCAST minimal CRISPR array
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB, TnsC and TniQ)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g1)-PGKpuroBFP-W
Plasmid#105025PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g2)-PGKpuroBFP-W
Plasmid#105026PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PTPN11i1
Plasmid#59612PurposeExpression of shRNA against human PTPN11DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only