We narrowed to 79,900 results for: INA
-
Plasmid#184061Purposecyclofen-inducible CRE activation in zebrafish permanent transgenicDepositorInsertCRE-ERT2
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.3 (19-361)
Plasmid#177846PurposeBacterial Expression of SnRK2.3DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral N
Plasmid#113009PurposeFor bacterial expression of MBP fusion of N terminal region of Drosophila TralDepositorAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C
Plasmid#113008PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila TralDepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C 15A
Plasmid#113007PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila Tral phosphomutant (15A)DepositorInsertC terminus of tral (tral Fly)
ExpressionBacterialMutationPNG phosphorylation sites mutated to AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7
Plasmid#136466PurposeMammalian expression of non-targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
ExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLifeAct-HyPer7
Plasmid#136464PurposeMammalian expression of F-actin targeted ultrasensitive hydrogen peroxide indicator HyPer7 fused with LifeAct peptide for optical imagingDepositorInsertHyPer7
TagsLifeActExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-N-HA-NEK7
Plasmid#75142PurposeExpresses N-terminal HA-tagged NEK7 in mammalian cellsDepositorInsertNIMA (never in mitosis gene a)-related expressed kinase 7 (Nek7 Mouse)
TagsHAExpressionMammalianPromoterCMVAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
dCas9-ddMSK1
Plasmid#165603PurposeExpresses Sp dCas9 fused to truncated inactive human MSK1 (42-802, D195A, D565A)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated inactive human Mitogen- and stress-activated protein kinase-1 (42-802, D195A, D565A) (RPS6KA5 S. Pyogenes, Human, Synthetic)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianPromoterEF1aAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQE30-HyPer7
Plasmid#141071PurposeBacterial expression of ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsHisx6ExpressionBacterialPromoterT5Available SinceMarch 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNK5785
Plasmid#219753PurposepGAP-like vector encoding mutant of Neonothopanus nambi luciferase nnLuz_v4 under control of GAP promoter, for yeast expressionDepositorInsertpGAP - nnLuz_v4 - tAOX
UseLuciferaseExpressionYeastAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-HTNC
Plasmid#13763PurposeFor expression and purification of a His-TAT-NLS-Cre fusion; HIV-TAT promotes cellular uptake of recombinant Cre into mammalian cells.DepositorInsertHis-TAT-NLS-Cre
UseBaculovirusTagsHis Tag, NLS, and TATExpressionBacterialPromoterp10 promoterAvailable SinceApril 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pET23a-H6-TEV-cSrc
Plasmid#214233PurposeBacterial expression of the kinase domain of cSrc with a TEV-cleavable N-terminal 6xHis affinity tag; For in vitro tyrosine phosphorylation in peptides/proteins and for kinase specificity screeningsDepositorAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-Cep152
Plasmid#136825PurposeMammalian expression of the centrosomal protein Cep152 N-terminally fused to SNAP-tagDepositorInsertSNAP-Cep152 (CEP152 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pnEA-vH_His-TEV-SEPT2
Plasmid#174491Purposebacterial expression of human SEPT2DepositorAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-ALMS1
Plasmid#136828PurposeMammalian expression of the centrosomal protein ALMS1 N-terminally fused to SNAP-tagDepositorInsertSNAP-ALMS1 (ALMS1 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-His10FLAG
Plasmid#157736Purposeempty pFastBac1 vector (polyhedrin promoter) adds enterokinase-removable N-terminal His10-tag + 3xFLAG tag; avoids unwanted residues in the final protein sequence by using the BseRI restriction sitesDepositorTypeEmpty backboneTagsHis10 + 3xFLAG, enterokinase-cleavableExpressionInsectPromoterpolyhedrinAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only