We narrowed to 6,717 results for: Rel
-
Plasmid#51879PurposeExpresses full-length Low-density lipoprotein receptor-related protein 8 ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertLRP8 (LRP8 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SMS1-TEV-Twin-Strep
Plasmid#202528PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged human Sphingomyelin synthase 1 (SMS1) in mammalian cellDepositorInsertSGMS1 (SGMS1 Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted stop codon (TAA)PromoterCAG and chicken β-actin promoterAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRosa26-EF1a-hCas9IRESneo
Plasmid#67987PurposeMouse Rosa26 targeting vector carrying the EF1a-hCas9-IRES-neo cassetteDepositorInsertEF1a-hCas9IRESneopA
ExpressionMammalianAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-tTA
Plasmid#210501Purposeexpresses LAUNCHER component in mammalian cellsDepositorInsertPDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-tTA
TagsMycExpressionMammalianPromoterCMVAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
ITGB2_pcDNA6.2/EmGFP-Bsd
Plasmid#176983PurposeMammalian expression vector encoding ITGB2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
EYFP-p65
Plasmid#111192Purposefluorescent fusion proteinDepositorAvailable SinceJune 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMDlg/pRRE-int-MS2M
Plasmid#166032PurposeExpression of bacteriophage-derived MS2 coat protein fused HIV-1 Lentiviral Gag-Pol at C terminal with a HIV-1 protease cleavage signal between MS2 and Gag-Pol.DepositorInsertGag-Pol-MS2
UseLentiviralMutationD64V mutation within the integrase within PolAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
IFNAR2_pcDNA6.2/EmGFP-Bsd
Plasmid#176938PurposeMammalian expression vector encoding IFNAR2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix
Plasmid#100795PurposeMammalian expression of Nix (Bnip3L)DepositorAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX-BSD-tet-mEGFP-MIB1
Plasmid#140241PurposeLentiviral vector expressing mEGFP-tagged MIB1 upon tetracycline treatmentDepositorInsertTet-inducible mEGFP-MIB1 (MIB1 Human)
UseLentiviralTagsmEGFPExpressionMammalianPromoterTREAvailable SinceJune 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDragon-p21
Plasmid#155016PurposeFor Flp-mediated cassette exchange. Expresses tdTomato in the presence of (r)tTA, switching to the cell cycle suppressor p21 in the presence of Cre and (r)tTA activityDepositorInsertCdkn1a (Cdkn1a Mouse)
UseMouse TargetingAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-15b_LC3B
Plasmid#73949PurposeFor recombinant expression of human LC3B/MAP1LC3B in E. coliDepositorAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CB-Cdkn1a
Plasmid#228914PurposeExpression CDKN1A in mammalian cellsDepositorInsertCdkn1a (Cdkn1a Mouse)
ExpressionMammalianAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-CDKN1A
Plasmid#228912PurposeExpression CDKN1A in mammalian cellsDepositorInsertCdkn1a (Cdkn1a Mouse)
ExpressionMammalianAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-vsfGFP-0
Plasmid#191097PurposeTo express a bright green nanobody FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-vsfGFP-0
UseAAVTagsGreen fluorescent protein bound to enhancer nanob…ExpressionMammalianMutationOptimized to Human codon usagePromoterCMV and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 IRF7(5’UTR)-FF
Plasmid#85490PurposeFirefly luciferase under the control of IRF7 5'UTRDepositorAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
RUNX1_pcDNA6.2/EmGFP-Bsd
Plasmid#176974PurposeMammalian expression vector encoding RUNX1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-AausFP1
Plasmid#191096PurposeTo express a bright green FP to label eucaryotic cell nuclei. To be used in tissue-clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-AausFP1
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationOptimized to Human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNIC-ZB-SPRTNwt-FL
Plasmid#110217PurposeExpression in E. coli of full-length wild-type SPRTN protein, with His and ZB tags at N-terminus.DepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 Mouse, sequence: GTCGCTACCTACAGCCAGGA)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only