We narrowed to 6,058 results for: cat.2
-
Plasmid#106317PurposeExpress Cas9 and sgRNA targeting MTHFD1LDepositorInsertsgRNA targeting MTHFD1L
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMST1211_BB2_E_AB_pcoxA:pyrGtrunc_AMA1_2.8
Plasmid#90285PurposeBB2 with split pyrG marker for homologous integration with linker AB (negative control)DepositorInsertpyrGtrunc
ExpressionBacterialMutationtruncated version of pyrG gene (sequence is from …Available SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMST1212_BB2_E_BC_pcoxA:pyrGtrunc_AMA1_2.8
Plasmid#90286PurposeBB2 with split pyrG marker for homologous integration with linker BC (for 1 expression cassette)DepositorInsertpyrGtrunc
ExpressionBacterialMutationtruncated version of pyrG gene (sequence is from …Available SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMST1213_BB2_E_CD_pcoxA:pyrGtrunc_AMA1_2.8
Plasmid#90287PurposeBB2 with split pyrG marker for homologous integration with linker CD (for 2 expression cassettes)DepositorInsertpyrGtrunc
ExpressionBacterialMutationtruncated version of pyrG gene (sequence is from …Available SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMST1214_BB2_E_DE_pcoxA:pyrGtrunc_AMA1_2.8
Plasmid#90288PurposeBB2 with split pyrG marker for homologous integration with linker DE (for 3 expression cassettes)DepositorInsertpyrGtrunc
ExpressionBacterialMutationtruncated version of pyrG gene (sequence is from …Available SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMT2 Cav2.2 DomI and DomII
Plasmid#89891PurposeMammalian expression of Cav2.2 DomI and DomII, this contains the first 2 domains (amino acids 1 -1154) of Cav2.2DepositorInsertCacna1b (CACNA1B )
ExpressionMammalianMutationStop codon after amino acid 1154 (this is a trunc…Promoteradenovirus major late promoterAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF792_2
Plasmid#86340PurposeEncodes gRNA for 3' target of human ZNF792DepositorInsertgRNA against ZNF792 (ZNF792 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_HOMEZ_2
Plasmid#86353PurposeEncodes gRNA for 3' target of human HOMEZDepositorInsertgRNA against HOMEZ (HOMEZ Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM3A_2
Plasmid#86322PurposeEncodes gRNA for 3' target of human KDM3ADepositorInsertgRNA against KDM3A (KDM3A Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_2
Plasmid#86315PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCXIX_sh_hBcl10_#2
Plasmid#75254Purposeretroviral shRNA vector against human BCL10, expresses GFP for transduction controlDepositorAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
Helios-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75246PurposeCRISPR/Cas9 NICKASE plasmid against human Helios (1/2)DepositorInsertsgRNA against human Helios (IKZF2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
Helios-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75247PurposeCRISPR/Cas9 NICKASE plasmid against human Helios (2/2)DepositorInsertsgRNA against human Helios (IKZF2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgDedd-2
Plasmid#74436PurposesgRNA expression vector for mouse Dedd gene targeting intron 4DepositorAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tg 2 kb Violet opsin GFP
Plasmid#72921Purposeviolet opsin promoter from zebra finch (Taeniopygia guttata) gDNA (nucleotides21,946 to 145, corresponding to chr1A_ran-dom:206453–208444 in taeGut1) driving GFPDepositorInsertviolet opsin promoter
Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tg 2 kb Violet opsin DsRed
Plasmid#72920Purposeviolet opsin promoter from zebra finch (Taeniopygia guttata) gDNA (nucleotides21,946 to 145, corresponding to chr1A_ran-dom:206453–208444 in taeGut1) driving DsRedDepositorInsertviolet opsin promoter
Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgGLDC_2
Plasmid#72887PurposeCRISPR-Cas9 induced gene disruptionDepositorInsertsgGLDC
UseLentiviralPromoterCMVAvailable SinceFeb. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF146_2
Plasmid#72361PurposeEncodes gRNA for 3' target of human ZNF146 along with Cas9 with 2A GFPDepositorInsertZNF146 (ZNF146 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_HHEX_2
Plasmid#72355PurposeEncodes gRNA for 3' target of human HHEX along with Cas9 with 2A GFPDepositorInsertHHEX (HHEX Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only