We narrowed to 73,658 results for: LAS
-
Plasmid#239218PurposeExpresses CDK11B with D562A kinase inactivating mutation and G579S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B with D562A kinase inactivating mutation and G579S resistance mutation (CDK11B Human)
UseLentiviralTagsExpressionMammalianMutationchanged Aspartic acid 562 to Alanine and changed …PromoterAvailable sinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E1-dTom-nlsdTom
Plasmid#135637PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E1 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E3-dTom-nlsdTom
Plasmid#135638PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E3 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E4-dTom-nlsdTom
Plasmid#135639PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E4 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E7-dTom-nls-dTom
Plasmid#135642PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E7 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E9-dTom-nls-dTom
Plasmid#135644PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E9 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E10-dTom-nlsdTom
Plasmid#135645PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E10 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
Pro-Code Vector Kit
Plasmid Kit#1000000177PurposeThe Pro-Code Vector Kit is a set of 120 lentiviral vector plasmids, each with a unique protein barcode (Pro-Code) and gRNA cloning site.These plasmids can be used for CRISPR screens.DepositorAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Nuclear Pro-Code Vector Kit
Plasmid Kit#1000000197PurposeThe Nuclear Pro-Code Vector Kit is a set of 75 lentiviral vector plasmids, each with a unique barcode (Pro-Code) and gRNA cloning site.DepositorAvailable sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP11851-pAAV-hDLX-minBG-iCre-4X2C-WPRE3-BGHpA (Alias: CN1851)
Plasmid#164450PurposeAAV vector for Cre expression in forebrain GABAergic interneurons. For use in combination with Cre-dependent transgenic mouse lines or co-infection with Cre dependent viral vectors.Has ServiceAAV PHP.eBInsertiCre
UseAAVTagsExpressionMutationPromoterminBetaGlobinAvailable sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EML4-ALK variant 3a G1202R
Plasmid#183830PurposeExpress EML4-ALK fusion variant 3a (E6a;A20) harboring ALK G1202R mutation in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of EML4 exon 1-6a and ALK exon…ExpressionMammalianMutationG1202RPromoterCMVAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EML4-ALK variant 3a L1196M/G1202R
Plasmid#183831PurposeExpress EML4-ALK fusion variant 3a (E6a;A20) harboring ALK L1196M/G1202R mutation in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of EML4 exon 1-6a and ALK exon…ExpressionMammalianMutationL1196M/G1202RPromoterCMVAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475RG502R-AVI
Plasmid#160480PurposeExpresses SARS-CoV-2 RBD-L455RA475RG502R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475RG502R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine, Alanine 475 to A…PromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RG496R-AVI
Plasmid#160479PurposeExpresses SARS-CoV-2 RBD-L455RG496R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RG496R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Glyci…PromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475R-AVI
Plasmid#160478PurposeExpresses SARS-CoV-2 RBD-L455RA475R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Alani…PromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRepCap6
Plasmid#110770PurposepRepCap6 contains both rep and cap genes from the AAV6 genome, but lacks the viral terminal repeats (Rutledge et al., 1998). It lacks adenovirus helper functions required for stock production.DepositorInsertAAV6 cap, AAV6 rep genes
UseAAVTagsExpressionMutationPromoterAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
SFG.CNb30_opt.IRES.eGFP
Plasmid#22493DepositorInsertCodon optimised Calcineurin B mutant 30 (PPP3R1 Human)
UseRetroviralTagsExpressionMutationL124T; K125-LA-InsPromoterAvailable sinceDec. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pACT5FVMF(f)
Plasmid#110549PurposeControl plasmid for titering FV by qPCR to determine the genome-containing particle number. This qPCR protocol is described in Hendrie et al., 2008DepositorInsertEGFP, FV LTRs
UseQpcr control for titering foamy virusTagsExpressionMutationPromoterpromoter: MLV LTRAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
T2A Split/Link TurboID Kit
Plasmid Kit#1000000249PurposeThe T2A Split/Link TurboID Kit uses a sequential Golden Gate assembly method and can be used to assemble mammalian expression vectors for proximity labeling experiments.DepositorAvailable sinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only