We narrowed to 25,664 results for: promoter
-
Plasmid#209969PurposeContains Level 0 Part: autoinducible Promoter (PfabZ) for the construction of Level 1 plasmidsDepositorInsertPromoter (P_fabZ)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP8
Plasmid#209970PurposeContains Level 0 Part: autoinducible Promoter (PgadB) for the construction of Level 1 plasmidsDepositorInsertPromoter (P_gadB)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP9
Plasmid#209971PurposeContains Level 0 Part: constitutive Promoter (PldhD) for the construction of Level 1 plasmidsDepositorInsertPromoter (P_ldhD)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP1
Plasmid#209963PurposeContains Level 0 Part: mock / negative control Promoter (P-nc) for the construction of Level 1 plasmidsDepositorInsertPromoter (mock)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP2
Plasmid#209964PurposeContains Level 0 Part: constitutive Promoter (P48) for the construction of Level 1 plasmidsDepositorInsertPromoter (P48)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRDA_186
Plasmid#133458PurposeU6 promoter expresses customizable Spyo-guide; PGK promoter expresses blasticidin resistance and 2A site provides EGFPDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pANTO5
Plasmid#131106PurposeTo generate an integrative plasmid carrying the TetR/Pip-OFF system, but not the integraseDepositorInserttetR gene by pFRA61 (Boldrin et al 2010)
ExpressionBacterialAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSEM235 - [Pmlc-1 | mcherry | cbr-tbb-2 UTR]
Plasmid#159900PurposeFluorescent co-injection marker to identify extrachromosomal arrays in C. elegansDepositorInsertPmlc-1 | mcherry | cbr-tbb-2 UTR
ExpressionWormPromoterPmlc-1Available SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-miR124
Plasmid#177806PurposeThe pre-miR-124 sequence has been inserted into the EcoRV of pCAG-nDsRedFL-intron.DepositorInsertmiR-124
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn spCas9
Plasmid#179725Purposehuman synapsin (hSyn)-driven spCas9 lentiviral vector for CRISPR/HITIDepositorInsertspCas9
UseLentiviralAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
px330 p300 gRNA
Plasmid#165591PurposeInsertion of p300 degronDepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETM6-C4-mCherry
Plasmid#66530PurposeExpresses mCherry under the control of Mutant T7 Promoter C4DepositorInsertmCherry
UseSynthetic BiologyExpressionBacterialMutationCodon Optimized for E. coliPromoterMutant T7 Promoter - C4Available SinceJuly 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPMVAd36
Plasmid#98302PurposeEnhancing the lower-part mevalonate pathway; overexpressing yeast mevalonate pathway genes under the control of consitutive promoters or CUP1 promoter.DepositorInsertPCUP1>ERG12>TNAT5-PTEF2>ERG8>TIDP1-TIDP1ExpressionYeastAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX-V5-TRAF2-puro
Plasmid#44111DepositorAvailable SinceMarch 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO MycLAP-STIL 5A
Plasmid#80267Purposemammalian expression plasmid for MycLAP-STIL 5ADepositorInsertSTIL (STIL Human)
TagsMyc-GFPExpressionMammalianMutationS1103A, S1108A, S1111A, S1116A, T1119APromoterCMVAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-PGK.Pro
Plasmid#79489PurposeMultiSite Gateway entry clones, first fragment, (attL1, attR5) Human PGK promoterDepositorAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIRES.Puro.EGFP
Plasmid#24176DepositorInsertEGFP
ExpressionMammalianMutationxAvailable SinceApril 9, 2010AvailabilityAcademic Institutions and Nonprofits only -
XE117 CAMKII-CS2+
Plasmid#16737DepositorInsertCAMKII (Camk2a Rat)
UseXenopus expressionAvailable SinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBAC690-TEF
Plasmid#160432PurposeExpresses eGFP under control of the yeast TEF2 promoterDepositorInsertS. cerevisiae TEF2 promoter
ExpressionYeastPromoterS. cerevisiae TEF2Available SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only