We narrowed to 17,393 results for: EMB
-
Plasmid#192951PurposeFor membrane insertion study; Expresses sptse5-CT (1169-1300) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1300)
TagsPelB signal peptideExpressionBacterialMutationencodes for sptse5 (1169-1300)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet1-6xHis-TEV-NDP52
Plasmid#190194PurposePlasmid for the protein expression of 6xHis-TEV-NDP52 in a bacterial expression system. Internal reference: SMC401DepositorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_L6_mKate2
Plasmid#167332PurposeExpresses mKate2 fused to TFAM L6 mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationChanged K136, H137, K139, R140, K146 and K147 to …PromoterCMVAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti C-MYC-DDK Puro PNRC1-W300A
Plasmid#123301PurposeMammalian expression of PNRC1-W300A mutant C-MYC-FLAGDepositorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX6p1-Rbck1
Plasmid#63135PurposeExpression of human RBCK1/HOIL-1LDepositorInsertHOIL-1L (RBCK1 Human, Synthetic)
TagsGSTExpressionBacterialMutationSynthetic based on human protein sequencePromotertacAvailable SinceMarch 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-FLAG-puro-PTPIP51(1-150_175-470)
Plasmid#170537PurposeExpresses PTPIP51 FFAT-like motif (151-175) deletion mutant (1-150_176-470) in human HeLa cells after transfectionDepositorInsertProtein tyrosine phosphatase interacting protein 51 (RMDN3 Human)
TagsFLAG tagExpressionMammalianMutationdeleted amino acids 151-175PromoterCAG promoterAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCENPTΔC-dCas9-3xGFP
Plasmid#198325PurposeExpresses CENPTΔC-dCas9-3xGFP protein in mammalian cells. When coupled with a guide RNA against a high repeat target locus, this can be applied to seed ectopic kinetochores at the target locusDepositorInsertCENPTΔC (CENPT Human)
UseLentiviralTagsEGFP x 3 and dCas9ExpressionMammalianMutationtruncation - encodes only amino acids 1-375PromoterCMV-TetOAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-mEGFP-MBP-TMD(ALA7)
Plasmid#193051PurposeExpression of artificial transmembrane protein tagged with mEGFP and MBP at the plasma membrane. Control construct for single molecule co-localization and co-tracking microscopy.DepositorInsertALA7-TMD
TagsIg k-chain leader sequence, MBP, and mEGFPExpressionMammalianPromoterCMVAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-1A32
Plasmid#191241PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-1A32 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), HLA-A (HLAA) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceFeb. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-1A31
Plasmid#191242PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-1A31 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), HLA-A (HLAA) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-CP8B1
Plasmid#191240PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-CP8B1 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), CYP8B1 (CYP12) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_dHMGA_mKate2_CLEAVAGE
Plasmid#167337PurposeExpresses mKate2 fused to TFAM dHMGA mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_HMGB_ctail_mKate2_CLEAVAGE
Plasmid#167338PurposeExpresses mKate2 fused to TFAM HMGB+C-tail mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHis-TEV-mCherry-LC3B-Gly (Microtubule-associated proteins 1A/1B light chain 3B)
Plasmid#169168PurposeConjugatable form of LC3B lacking 5 C-terminal amino acids (MKLSV), with C-terminal Glycine120 exposed for lipidation reaction.DepositorInsertMAP1LC3B (MAP1LC3B Human)
Tags6X Histidine Tag, TEV cleavage site, mCherryExpressionBacterialPromoterT7 lac promoterAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
KTD101(DE3)
Bacterial Strain#138651PurposeKTD101(DE3) is a trigger factor deficient strain, which may increase protein secretion from Escherichia coli, and is compatible with expression from the T7 promoterDepositorBacterial ResistanceNoneSpeciesEscherichia coliAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAraGFP
Plasmid#39548DepositorInserteGFP
ExpressionBacterialAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAraTM
Plasmid#39547DepositorTypeEmpty backboneExpressionBacterialPromoterTacAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only