We narrowed to 6,058 results for: cat.2
-
Plasmid#210361PurposeExpresses STIM1 fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only
-
GLG1-2Strep
Plasmid#210362PurposeExpresses GLG1 fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
DNAJC11-EGFP
Plasmid#210368PurposeExpresses DNAJC11 fused with EGFP in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpHG_N
Plasmid#147033PurposeBacterial Expression vectorDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP650
Plasmid#135000PurposeVP64-m6A Reader. Activates transcription near Gm6ATC sites. pUBC-DpnI(aa146-254)-VP64-V5 pGK-ZeoRDepositorInsertpUBC-DpnI(aa146-254)-VP64-V5 pGK-ZeoR
UseLentiviral and Synthetic BiologyTagsDpnI(aa146-254), V5 tag, and VP-64ExpressionMammalianMutationDpnI truncated to aa146-254Available SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnEK-NvS_M
Plasmid#146926PurposeBacterial Expression vectorDepositorTypeEmpty backboneExpressionBacterialAvailable SinceFeb. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-DEPTOR S286/287/291A
Plasmid#159160PurposeExpresses DEPTOR S286/287/291A mutant in mammalian cellsDepositorInsertDEPTOR (DEPTOR Human)
TagsHAExpressionMammalianMutationchanged serine 286,287 and 291 to alaninePromoterCMVAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-DEPTOR S286/287/291D
Plasmid#159161PurposeExpresses DEPTOR S286/287/291D mutant in mammalian cellsDepositorInsertDEPTOR (DEPTOR Human)
TagsHAExpressionMammalianMutationchanged serine 286,287 and 291 to aspartic acidPromoterCMVAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-hsg(M)
Plasmid#138262PurposeSubcloning and expression of mCherry-targeting sgRNA M for use in Traffic Light reporter systemDepositorInsertsgRNA M
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBP-pET-RBS
Plasmid#72981PurposePET RBS - derived from pET vectors (5' GTAC/3' CATA fusion)DepositorInsertpET RBS derived from pET vectors
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-lacZ
Plasmid#72948PurposeEntry vector for Bioparts - Oligo anneal or PCR with internal BsaI sites at 5' and 3' ends using NdeI/SphI cloningDepositorInsertLevel 0 - Bioparts
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-2P-N317P
Plasmid#196378PurposeMammalian cell expression of SARS-CoV-2 Spike protein with mutation N317P with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-2P-N317P (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Target Zfp462-Klf4SE
Plasmid#127668PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter; 2 gRNAs targeting the Zfp462 promoter and 2 gRNAs targeting the Klf4 SE expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 129, 135, 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pO3
Plasmid#193748PurposeExpresses E2-Crimson under the control of PAAH synthetic promoter regulated by AHL and aTc, p15A origin of replication, Chloramphenicol selectionDepositorInsertE2-Crimson
ExpressionBacterialPromoterPAAHAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pO6
Plasmid#193747PurposeExpresses E2-Crimson under the control of PIAH synthetic promoter regulated by AHL and IPTG, p15A origin of replication, Chloramphenicol selection,DepositorInsertE2-Crimson
ExpressionBacterialPromoterPIAHAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLPO2
Plasmid#209976PurposeContains Level 0 Part: replication origin (SH71rep) for the construction of Level 1 plasmidsDepositorInsertreplication origin (SH71_rep)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-syn-flex-iGluSnFR4f-PDGFR-WPRE
Plasmid#234440PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmKO-imp α
Plasmid#200082PurposeExpresses mKO-tagged human importinα in mammalian cellsDepositorAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only