We narrowed to 14,567 results for: cas9 genes
-
Plasmid#237396PurposePeft-3::Cas9 + ChrIV sgRNADepositorInsertPeft3::Cas9 + ChrIV sgRNA
Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
CD55-Delta1
Plasmid#220870PurposeExpresses CD55 variant in mammalian cellsDepositorInsertCD55 Delta-1
TagsEGFPExpressionMammalianMutationDelta-1, the first short consensus repeat (SCR) d…PromoterCMVAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNES-FRB-ZFPTS2-3xFLAG-2xNLS
Plasmid#107303PurposeExpresses ZFP-VEGFA-TS2 fused to FRB in mammalian cellsDepositorInsertZFP_VEGFA-TS2
UseCRISPRTags2xNES, 3x Flag, 2xNLS, and FRBExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNES-FRB-ZFPTS3-3xFLAG-2xNLS
Plasmid#107304PurposeExpresses ZFP-VEGFA-TS3 fused to FRB in mammalian cellsDepositorInsertZFP_VEGFA-TS3
UseCRISPRTags2xNES, 3x Flag, 2xNLS, and FRBExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP012
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA
Plasmid#47108PurposeExpresses a S. pyogenes Cas9/dCas9 guide RNA in mammalian cellsDepositorHas ServiceCloning Grade DNAInsertSPgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHSN6A01
Plasmid#50586PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN6I01
Plasmid#50587PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBUN6A11
Plasmid#50579PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBUN6I11
Plasmid#50580PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN501
Plasmid#50589PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationCas9D10A nickase, was derived from the zCas9 and …Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBS31-cCARLIN
Plasmid#160928PurposeContains 10 constitutively expressed guide RNAs and CAG-GFP-CARLIN array sequence for DNA barcoding (when used in combination with Cas9)DepositorInsertCARLIN gRNAs and CAG-GFP-CARLIN array
UseMouse TargetingExpressionMammalianPromoterU6 promoter for gRNAs; CAG promoter for GFPAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3052(gRNA X-4, XI-3, XII-5)
Plasmid#73294PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-4, XI-3, and XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBUN501
Plasmid#50582PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Bar resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationCas9D10A nickase, was derived from the zCas9 and …PromoterAtU6-26p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_non-targeting
Plasmid#140109PurposeCRISPR-Cas9 library validation (negative control)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB3051(gRNA X-3 XI-2 XII-2)
Plasmid#73293PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-3, XI-2, and XII-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_CEACAM1
Plasmid#140102PurposeCRISPR-Cas9 library validationDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_Rat_cebp-alfa
Plasmid#140098PurposeCRISPR-Cas9 library validation (positive control)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_SPI1
Plasmid#140099PurposeCRISPR-Cas9 library validation (positive control)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only