We narrowed to 25,285 results for: crispr
-
Pooled library#83994PurposeMouse CRISPRi Pooled Library targeting membrane proteinsDepositorAvailable sinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only
-
hCRISPRi-v2, Cancer and Apoptosis (h2), top 5 sgRNAs/gene
Pooled library#83972PurposeHuman CRISPRi Pooled Library targeting cancer and apoptosis genesDepositorAvailable sinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCBh-NLS_dCas13d_HA_NLS-pA-U6-DR-BpiI-BpiI-pSV40-EGFP-pA-pSV40-mCherry-pA
Plasmid#191797Purposevector for encoding a human codon-optimized dead RfxCas13d (dCas13d) driven by CBh promoter, guide RNAs compatible with RfxCas13d driven by hU6, EGFP driven by SV40 promoter, and mCherry driven by SV40 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthumanized dCas13d
UseCRISPRExpressionMammalianMutationR239A, H244A, R858A, H863APromoterCBh, SV40, hU6Available sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Gene Expression (h5), top 5 sgRNAs/gene
Pooled library#83984PurposeHuman CRISPRa Pooled Library targeting gene expressionDepositorAvailable sinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJW1311
Plasmid#61254PurposeTemplate for cloning sgRNA(F+E) to generate new PU6::sgRNAs by PCR-fusionDepositorInsertsgRNA(F+E) targeting Y61A9L9.1
UseCRISPR; Cloning templateAvailable sinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FR-E01
Bacterial strain#118727PurposeExpression of dCas9 gene under the control of a Ptet promoter in the E. coli chromosomeDepositorBacterial resistanceNoneAvailable sinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJT258 Lenti pEF-dCas9-3XFLAG-N+F+Z-T2A-tagBFP-P2A-Blast
Plasmid#187334PurposedCas9 effector fusion for manipulating transcriptionDepositorInsertdCas9-3XFLAG-N+F+Z-T2A-tagBFP-P2A-Blast
UseCRISPR and LentiviralTags3XFLAGExpressionMammalianPromoterpEF1aAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV-CjABE8e
Plasmid#189929PurposePlasmid encoding CjABE8e driven by the CMV promoter for plasmid transfection.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCjABE8e
ExpressionMammalianMutationCjCas9 D8APromoterCMVAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJW2171
Plasmid#163095PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mNeonGreen (dpi)::AID*::3xFLAG::10aa linker
UseCRISPRExpressionWormMutationSilent mutations to remove piRNA sitesAvailable sinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
ABE8.20-d
Plasmid#136301Purposeexpresses ABE8.20-d in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertABE8.20-d
TagsC-terminal BPNLSExpressionMammalianMutationD10A in S. pyogenes Cas9, TadA mutations describe…PromoterCMVAvailable sinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSH-EFIRES-P-Seipin-miniIAA7-3XFlag
Plasmid#129722PurposeAAVS1 safe harbor targeting vector expressing miniIAA7-3XFlag tagged SeipinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSeipin (BSCL2 Human)
UseCRISPR and TALEN; Human safe harbor locus (a avs1…TagsminiIAA7-3XFlagExpressionMammalianMutationsilent mutationsPromoterEF1aAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-3sgRNA
Plasmid#64241Purposedestination vector for three U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGGDestTol2LC-2sgRNA
Plasmid#64240Purposedestination vector for two U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDD315 (mTurquoise2^SEC^2xHA)
Plasmid#73343PurposemTurquoise2^SEC^2xHA vector with ccdB sites for cloning homology armsDepositorInsertmTurquoise2-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags2xHA and C. elegans codon-optimized mTurquoise2ExpressionWormAvailable sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hRad51(A89E)–Cas9(D10A)
Plasmid#125563PurposeExpresses the Rad51(A89E)–Cas9(D10A) fusion construct in mammalian cells under CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRad51(A89E)–Cas9(D10A) (RAD51 Human)
UseCRISPRExpressionMammalianAvailable sinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-50: NPM1-mEGFP
Plasmid#109122PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human NPM1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNPM1 Homology Arms with linker-mEGFP (NPM1 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available sinceMay 4, 2018AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pCBh_NLS_dCas13X_NLS-pA-U6-DR-BpiI-BpiI-DR-pSV40-EGFP-pA-pSV40-mCherry-pA
Plasmid#191796Purposevector for encoding a human codon-optimized dead Cas13X (dCas13X) driven by CBh promoter, guide RNAs compatible with Cas13X driven by hU6, EGFP driven by SV40 promoter, and mCherry driven by SV40 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthumanized dCas13X
UseCRISPRExpressionMammalianMutationR84A, H89A, R739A, R740A, H745A, H746A, H747APromoterCBh, SV40, hU6Available sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only