We narrowed to 520 results for: mRuby2
-
Plasmid#160858PurposePJ23110-RBS-FaAAT2-mRuby2-tL3S2P24_KanR_p15ADepositorInsertAlcohol acyl transferase
UseSynthetic BiologyTagsmRuby2ExpressionBacterialPromoterPJ23110Available sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pME-Ruby2-NS
Plasmid#166569PurposeMultisite Gateway middle entry clone encoding mRuby2. Parton lab clone DJADepositorInsertRuby2
UseGateway CloningAvailable sinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
MTK0_057
Plasmid#123950PurposeEncodes the hAAVS1 BxBI recognition site with Hygromycin resistance and mRuby2 landing pad with GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInsertBxBI LP on hAAVS1 (Hygro::mRuby)
ExpressionMammalianAvailable sinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ANLN_sgRNA
Plasmid#183876PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorAvailable sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ACTB_sgRNA
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-TUBA1B_sgRNA
Plasmid#183888PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and TUBA1B sgRNA for N-terminal tagging of alpha-tubulin in human cells.DepositorAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-RHOA_sgRNA
Plasmid#183877PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.242
Plasmid#73754PurposeNabi2.242 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.242
ExpressionMammalianAvailable sinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYSD313
Plasmid#212931PurposeEncodes the Aga2 signal peptide, mRuby2 fluorescent protein HA-tagged Sed1p yeast surface display anchor protein with pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertSed1 (SED1 Budding Yeast)
ExpressionYeastAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTS2389-Tier1-PhCMV-p2a_mRuby
Plasmid#169526PurposeTier-1 vector encoding PhCMV-driven red fluorescent protein mRuby2 fused to a "self-cleaving" peptide p2a (PhCMV-p2a_mRuby2-pA).DepositorInsertPCMV-driven P2A-fused enhanced yellow fluorescent protein
ExpressionMammalianPromoterPhCMVAvailable sinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-GFP11-RhoA
Plasmid#181860PurposePart of FluoSTEP-RhoA biosensor; co-express with cpPKN-mRuby2-GFP1-10 (Addgene #181859).DepositorAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25K3
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianPromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.244
Plasmid#73756PurposeNabi2.244 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.244
ExpressionMammalianAvailable sinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ECT2_sgRNA
Plasmid#183875PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-CfANLN_sgRNA
Plasmid#183879PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRExpressionMammalianPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-H2BC11_sgRNA
Plasmid#183881PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-MYH10_sgRNA
Plasmid#183886PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.DepositorAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
MTK0_012
Plasmid#123967PurposeEncodes the hROSA26 BxBI recognition site with Hygromycin resistance and mRuby2 landing pad with GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInserthRosa26-BxBI landing pad
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIA3
Plasmid#109399PurposeExpresses sgRNA cassette (BsmBI cloning site) and EF1-A driven eSpCas9 linked via P2A with mRuby2 and dominant negative mtp53 for enhanced survival of hES after DSBDepositorTypeEmpty backboneUseCRISPRTagsmRuby2 and mtp53dnExpressionMammalianPromoterEF1aAvailable sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by