We narrowed to 5,561 results for: IRES
-
Plasmid#182879PurposeLentivirus for expression of Plexin-B2 locked ring mutantDepositorInserthPLXNB2 (PLXNB2 Human)
UseLentiviralMutationchanged Isoleucine 436 to Cysteine and Serine 993…Available SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-PB2_Lock2-I436C+T1051C
Plasmid#182880PurposeLentivirus for expression of Plexin-B2 locked ring mutantDepositorInserthPLXNB2 (PLXNB2 Human)
UseLentiviralMutationchanged Isoleucine 436 to Cysteine and Threonine …Available SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
SFFV-BCL11B-Brd 58
Plasmid#219038PurposeTranscription factor BCL11B with a specific barcode assigned.DepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag DAK
Plasmid#20473DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLEX305_FKBP12F36V-SHOC2
Plasmid#134522PurposeLentiviral plasmid expressing SHOC2 with N-term FKBP12(F36V) tagDepositorInsertSHOC2 (SHOC2 Human)
UseLentiviralTagsFKBP12F36V-2xHAExpressionMammalianMutationSilent mutations made at wobble base position at …PromoterhPGKAvailable SinceNov. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag FGFR1
Plasmid#20486DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag GCK
Plasmid#20492DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag AKT3
Plasmid#20423DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
RF15
Bacterial Strain#102799PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. aspC tyrB trpA trpB glyA serB genes deleted.DepositorBacterial ResistanceNoneAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
SHP2(WT)@pLKO-Trex-SBP
Plasmid#85457PurposeGene expressionDepositorAvailable SinceFeb. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
SHP2(C459S)@pLKO-Trex-HA
Plasmid#85459PurposeExpresses SHP2 mutant in mammalian cellsDepositorAvailable SinceFeb. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
SHP2(T253M/Q257L)@pLKO-Trex-SBP
Plasmid#85458PurposeSHP2 mutant gene expressionDepositorInsertSHP2 (PTPN11 Human)
UseLentiviralTagsSBP TagExpressionMammalianMutationT253M/Q257LPromoterRSVAvailable SinceFeb. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
EMMA toolkit
Plasmid Kit#1000000119PurposeCollection of Golden Gate vectors and standardized genetic parts for the construction mammalian expression plasmids.DepositorApplicationCloning and Synthetic BiologyVector TypeMammalian ExpressionCloning TypeGolden GateAvailable SinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP2 (identifier AAAA-0244)
Plasmid#202553PurposeNontargeting control vector with TagBFP2DepositorInsertHumanized dCas9-KRAB-TagBFP2 (tag blue fluorescent protein 2) (TRIM28 S. Pyogenes (dCas9), H. sapiens (KRAB), Entacmaea quadricolor (TagBFP2))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2MutationPuromycin-resistance gene in the pLV hU6-sgRNA hU…Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV_pMBP-EGFP-caax (AAV8)
Viral Prep#190155-AAV8PurposeReady-to-use AAV8 particles produced from AAV_pMBP-EGFP-caax (#190155). In addition to the viral particles, you will also receive purified AAV_pMBP-EGFP-caax plasmid DNA. MBP-driven EGFP expression in oligodendrocytes. These AAV preparations are suitable purity for injection into animals.DepositorPromoterMBPAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV_pMBP-EGFP-caax (AAV1)
Viral Prep#190155-AAV1PurposeReady-to-use AAV1 particles produced from AAV_pMBP-EGFP-caax (#190155). In addition to the viral particles, you will also receive purified AAV_pMBP-EGFP-caax plasmid DNA. MBP-driven EGFP expression in oligodendrocytes. These AAV preparations are suitable purity for injection into animals.DepositorPromoterMBPAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKP332 (Lenti-OSK1)
Plasmid#21627DepositorUseCre/Lox and LentiviralExpressionMammalianAvailable SinceNov. 12, 2009AvailabilityAcademic Institutions and Nonprofits only