We narrowed to 12,110 results for: NSI
-
Plasmid#184510PurposeMammalian expression of Synaptotagmin 9 with pH-sensitive fluorescent proteinDepositorAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pCI pHluorin Syt8
Plasmid#184509PurposeMammalian expression of Synaptotagmin 8 with pH-sensitive fluorescent proteinDepositorAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCI pHluorin Syt3
Plasmid#184504PurposeMammalian expression of Synaptotagmin 3 with pH-sensitive fluorescent proteinDepositorAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2880
Plasmid#193117PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.6
UseSynthetic BiologyAvailable SinceMay 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPW3757 : CMVd3-ERmembrane-2xHaloTag-KKMP
Plasmid#185679PurposeLow-level transient expression of two tandem HaloTag proteins targeted to the ER membrane.DepositorInsertERmembrane-2xHaloTag-KKMP
ExpressionMammalianAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB3277
Plasmid#193131PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.4
UseSynthetic BiologyAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2888
Plasmid#193126PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.4
UseSynthetic BiologyAvailable SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-VC155
Plasmid#194051PurposeTransient expression of VN155 (mVenus β-strands 8 to 11, amino acids 155−239) in plant cell (Cytosol)DepositorInsertVC155 (mVenus β-strands 8 to 11, amino acids 155−239)
ExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2886
Plasmid#193124PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.3
UseSynthetic BiologyAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-AtOEP7(1-50aa)-mVenus
Plasmid#194000PurposeTransient expression of AtOEP7-mVenus in plant cell (Chloroplast outer envelope membrane)DepositorInsertmVenus
TagsAtOEP7 1–50aaExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-VN154
Plasmid#194050PurposeTransient expression of VN154 (mVenus β-strands 1 to 7, amino acids 1−154) in plant cell (Cytosol)DepositorInsertVN154 (mVenus β-strands 1 to 7, amino acids 1−154)
ExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2883
Plasmid#193120PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.4
UseSynthetic BiologyAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2882
Plasmid#193119PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.3
UseSynthetic BiologyAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2878
Plasmid#193115PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.1
UseSynthetic BiologyAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2881
Plasmid#193118PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.2
UseSynthetic BiologyAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2887
Plasmid#193125PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.6
UseSynthetic BiologyAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3275
Plasmid#193129PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.2
UseSynthetic BiologyAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3276
Plasmid#193130PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.3
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3271
Plasmid#193121PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.7
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2884
Plasmid#193122PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.2
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3274
Plasmid#193136PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA3 (GB1724) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G3aG2b.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2889
Plasmid#193127PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.5
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3272
Plasmid#193134PurposeA2 Proximal promoter sequence consisting of the target sequence for the gRNA1 (GB1838) at "b site" (-210 from TSS).DepositorInsertGB_SynP (A2) G1b.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2891
Plasmid#193128PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2885
Plasmid#193123PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2879
Plasmid#193116PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.5
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3278
Plasmid#193132PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.5
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB3273
Plasmid#193135PurposeA2 Proximal promoter sequence consisting of the target sequence for the gRNA1 (GB1838) at "e site" (-320 from TSS).DepositorInsertGB_SynP (A2) G1e.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
p-preSufI(IAC)
Plasmid#168516PurposeModified form of pre-SufI in pET25b. With C-terminal HHHHHHC (6xHisC) extension and mutations C17I and C295A.DepositorInsertpre-SufI(IAC)
Tags6xHisC tag and HSV tagExpressionBacterialMutationC17I and C295APromoterT7Available SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET15 PemrR-gfp biosensor
Plasmid#185793PurposeThe pET15 PemrR-gfp biosensor is transcriptional fusion of GFP with the promoter of the emrRAB operon. This biosensor is responsive to monoaromatics, such as vanillin and syringaldehyde.DepositorInsertpEmrR-gfp
TagsEGFPExpressionBacterialPromoterPemrRAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH1001-Tier2(ColE1 ori)
Plasmid#169599PurposeTier-2 expression vector (A1-pA::A2-pA::A3-pA). The tier-2 expression vector consists of a custom MCS cassette containing the three Tier-1 compatible acceptor cassettes (A1, A2, and A3) each with its own non-homologous polyadenylation (pA) signals in a minimal backbone (AmpR and ColE1 ori).DepositorTypeEmpty backboneExpressionMammalianAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP.N3-myc-SLC35A2
Plasmid#186285Purposetransient expression of N-terminal myc tagged SLC35A2 isoform c/UGT1 in mammalian cellsDepositorAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0905
Plasmid#177068PurposeMoClo Level 1, position 1, transcriptional unit for transient expression of gal4AD-phiC31 driven by 35S promoterDepositorInsertgal4AD-phiC31
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDS12_TP-MpSIG2
Plasmid#136093PurposeChloroplast transit peptide from MpSIG2. For N-term fusion with a CTAGDepositorInsertTP-MpSIG2, Mapoly0214s0004
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEPQD0CM0063
Plasmid#177021PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertgeraniol synthase
UseSynthetic BiologyMutationtransit peptide removedAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-MtrxRFP2
Plasmid#172323Purposefluorescent biosensor for the redox of mitochondrial specific thioredoxin (Trx2)DepositorInserthuman thioredoxin 2, fused with a redox-sensitive RFP through Gly-Ser-rich linker
TagsHis-tagExpressionBacterialPromoterpBADAvailable SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTJV1ScGm-rpoB
Plasmid#166979PurposeGenerates ssDNA in vivo targeting E. coli rpoB for recombineering w/ Beta recombinase; temp. sensitive pSC101 ori and sgRNA for Cas9 counterselection; aacC1 for gentamycin resistanceDepositorInsertgentamycin-3-acetyltransferase (aac(3)-Ia )
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSF-ChPylTMSK
Plasmid#163915PurposetRNA synthetase/tRNA pair for the in vivo incorporation of N6-(((Trimethylsilyl)methoxy)carbonyl)-L-lysine (TMSK), into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAS1_4x7SKPylT_EF1_Ub-BsmBI-HA_IRES_BSD
Plasmid#162805PurposeSTELLA destination plasmid with HA terminal tag; Suitable for amber suppression (4xMmaPylT cassette); for transient or stable piggyBac-mediated integrationDepositorInsertUb-BsmBI-HA_IRES_Blasticidin
UsePiggybacTagsHAExpressionMammalianPromoterEF1alphaAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only