We narrowed to 9,684 results for: CAG
-
Plasmid#189945PurposeLentiviral vector to co-express a mouse Serpinh1 spsgRNA (sg2-Serpinh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Serpinh1 spsgRNA #2
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-tdTomato166/892
Plasmid#188488PurposegRNA plasmid with neo resistance expressing a double cutting single gRNA targeting tdTomato fluorescent protein sites 166 & 892.DepositorInserttdTomato sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056J
Plasmid#183136PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK14 pCAS-Tyr-[gRNA: 4=XII-5] (SplitKanR, AmpR)
Plasmid#178998PurposeSp.Cas9 and gRNA yeast expression vector withXII-5 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shSpc25
Plasmid#160960PurposeSpc25 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS424-ysg(G:H)
Plasmid#138257PurposeExpression of GFP-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequence to be used in yeast dual reporter systemDepositorInsertGFP targeting sgRNAs G and H
UseCRISPRExpressionYeastPromoterSNR52Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(G:H)
Plasmid#138259PurposeExpression of humanized mCherry-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequences to be used in Traffic Light reporter systemDepositorInsertmCherry targeting sgRNAs G and H
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDR-itga9_sgRNA4
Plasmid#132980Purposeitga9 sgRNA targeting to "5'-TCCGCTGCCAGCCAGCCGG-3" in pDR274DepositorInsertitga9 sgRNA4 target sequence
UseCRISPR; Sgrna generation vectorAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.PAPD4-2
Plasmid#128757PurposeExpresses PAPD4 gRNA for CRISPRiDepositorAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBL601 AG
Plasmid#126952PurposeTo target a protospacer with AG at the cut site.DepositorInsertspacer against human genome with AG at cut site
ExpressionMammalianPromoterhuman U6Available SinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga2#2
Plasmid#122290PurposeKnockdown for mouse Hmga2DepositorAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Geph UTR3m shRNA
Plasmid#121071PurposeNegative control shRNA for plasmid 121070: shRNA targeting the 3'-untranslated region (UTR) of the gephyrin mRNADepositorInsertGPHN shRNA (Gphn Rat)
UseRNAiAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
gh46
Plasmid#106709Purposeexpression of gRNA targeting ST6GALNAC5DepositorInsertST6GALNAC5 (ST6GALNAC5 Human)
ExpressionMammalianAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC45
Plasmid#104819PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-2). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN155
Plasmid#91684PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only