We narrowed to 894 results for: 1182
-
Plasmid#1182DepositorAvailable SinceAvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
AP-APP
Plasmid#196706PurposeExpresses APP695 with a biotin Acceptor Peptide tag at N-terminal for single molecule tracking and other measusers in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
TagsAP, Avitag and HAExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Tol2-PA2-CMV-AB-mCh
Plasmid#160435PurposeExpresses human Amyloid Beta-mCherry in ZebrafishDepositorInsertHuman Amyloid Beta peptide (1-42) (APP Human, Zebrafish)
UseZebrafish expressionTagsmCherryPromoterCMVAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-4
Plasmid#223225Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-3
Plasmid#223224Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-1
Plasmid#223223Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
6MIW
Plasmid#127291PurposeBacterial expression for structure determination. May not contain entire coding region of geneDepositorAvailable SinceJune 18, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCB268
Plasmid#53363PurposepcDNA3.0-based plasmid encoding fDHFR-UbK48R-Aβ42 13myc under the control of T7 or CMV promoter for 35S-pulse-chase URT-based assays in rabbit reticulocyte extract.DepositorTags13xMyc, Flag, and HAExpressionMammalianPromoterCMVAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5LdeltaER-SBP-mCitrine
Plasmid#154846PurposeSynchronize trafficking of Stx5LdeltaER (M55V) from the ER, for use with FLIM (RUSH system)DepositorInsertStx5 (Long isoform) (STX5 Human)
TagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationChanged Methionine 55 to Valine, causes loss of S…PromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5L(M55V)-SBP-mCitrine
Plasmid#209846PurposeSynchronize trafficking of Stx5L (M55V) from the ER, for use with FLIM (RUSH system)DepositorInsertSTX5 (STX5 Human)
TagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationChanged Methionine 55 to Valine, causes loss of S…PromoterCMVAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5S-SBP-mCitrine
Plasmid#154845PurposeSynchronize trafficking of Stx5S from the ER, for use with FLIM (RUSH system)DepositorInsertStx5 (Short isoform) (STX5 Human)
TagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationLacks amino acids 1-54, enocdes short isoform of …PromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationMutations to disrupt the uORFs and the stem-loop …Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
TP53I3
Plasmid#38849PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X31
Plasmid#59255PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt80-ex5-7
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTY-EF1a-Hoxa9-p2a-MeisI-p2a-GFP
Plasmid#61738PurposeExpress Hoxa9 and MeisI to induce leukemic transformation. GFP label transduced cells.DepositorInsertHoxa9-MeisI-GFP
UseLentiviralPromoterEF1aAvailable SinceMarch 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
SFG.CNb30_opt.IRES.eGFP
Plasmid#22493DepositorInsertCodon optimised Calcineurin B mutant 30 (PPP3R1 Human)
UseRetroviralMutationL124T; K125-LA-InsAvailable SinceDec. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
SFG.wtCNb_opt.IRES.eGFP
Plasmid#22492DepositorInsertCodon optimised wild type Calcineurin B (PPP3R1 Human)
UseRetroviralAvailable SinceDec. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMG
Plasmid#58991PurposeMSCV based expression vector - expresses GFPDepositorTypeEmpty backboneUseRetroviral; Mscv-based retroviral system that exp…ExpressionMammalianPromoterMSCVAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only