We narrowed to 1,042 results for: Psp
-
Plasmid#186406PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter HA tag under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway CloningAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pMS19: pHelper(PmcCAST)_PmcPSP1_ΔTniQ
Plasmid#168152PurposeInducible expression of PmcCAST proteins (except TniQ) with crRNA targeting PmcPSP1.DepositorInsertsPmcCAST minimal CRISPR array (with spacer for PmcPSP1)
PmcCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
PmcCAST Tns proteins (TnsAB, TnsC and TnsD)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS2: pHelper(AvCAST)_AvPSP1_ΔTniQ
Plasmid#168134PurposeInducible expression of AvCAST proteins (except TniQ) with crRNA targeting AvPSP1.DepositorInsertsAvCAST minimal CRISPR array (with spacer for AvPSP1)
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB and TnsC)
AvTnsD
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSP64-EMTB-GFP-ePDZ
Plasmid#135600PurposeExpression of EMTB-GFP-ePDZ mRNA for microinjection for use of optogenetics in S. purpuratusDepositorInsertEMTB-GFP-ePDZ
UseIn vitro transcription (mrna synthesis)TagsEGFP and ePDZPromoterUnknownAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSP64-Lifeact-GFP-ePDZ
Plasmid#135602PurposeExpression of Lifeact-GFP-ePDZ mRNA for microinjection to be used for optogenetics in S. purpuratusDepositorInsertLifeact-GFP-ePDZ
UseIn vitro transcription (mrna synthesis)TagsEGFP and ePDZPromoterUnknownAvailable SinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSPL10F13R13::pBIB-BAS (gSPL10)
Plasmid#27407DepositorInsertSPL10 (AT1G27370 Mustard Weed)
UseUsed to create transgenic linesAvailable SinceApril 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
6mpSPL10F13R13::pBIB-BAS (6mSPL10)
Plasmid#27408DepositorInsertSPL10 mutant (AT1G27370 Mustard Weed)
UseUsed to create transgenic linesMutationmiR156 target sites of SPL10 mutatedAvailable SinceMarch 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSP64T XAR1-myc (DM#121)
Plasmid#15049DepositorAvailable SinceOct. 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDSM-cd-Psptdh3-ACO-Tagtef1
Plasmid#127734PurposeYeast pathway position 4. ACO transcription unit with the S. paradoxus TDH3 promoter and A. gossypii TEF1 terminator.DepositorInsertaconitase
UseSynthetic BiologyExpressionYeastPromoterPsptdh3AvailabilityAcademic Institutions and Nonprofits only -
pzk408-pmax-3xflag-dpspCas13b(AAAA)-NES
Plasmid#196828PurposeExpress dpdpCas13b with AAAA mutationDepositorInsertdpspCas13b(AAAA)
Tags3XFLAG and NESExpressionMammalianMutationK367A, D369A and K370AAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSP72-RBM8A-3'UTR AluY-Sz WT 2598-4066
Plasmid#175587Purposein vitro transcription of wt RBM8A 3'UTRDepositorInsertRBM8A-3'UTR AluY-Sz WT
UseIn vitro transcriptionPromoterT7Available SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-8
Plasmid#129048Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA8 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA8 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SgmouseTSDR-1
Plasmid#129053Purposetargeted DNA demethylation_mouse_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA1 targeting mouse TSDRDepositorInsertdCas9-huTET1CD, SgRNA1 (mouseTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-1
Plasmid#129041Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA1 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA1 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-8
Plasmid#129036Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA8 targeting human TSDRDepositorInsertdCas9-huTET1CD, SgRNA8 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-1
Plasmid#129029Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA1 targeting human TSDRDepositorInsertdCas9-huTET1CD, SgRNA1 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75233PurposeCRISPR/Cas9 plasmid against human NFATc2DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA
Plasmid#186407PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway CloningAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only