We narrowed to 15,541 results for: sacs
-
Plasmid#107055PurposeBackbone vector for cloning in target sgRNA for use with SaCas9 (SauCas9)DepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-pMecp2-dSaCas9-KRAB-pU6-sgRNA
Plasmid#158988PurposeVector E encodes pAAV-pMecp2-dSaCas9-KRAB-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-KRAB
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpMecp2Available sinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBK1314-AAV-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223159PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
1782_pAAV-U6-Ai9-Sa-gRNA2-CB-SACas9-HA-OLLAS-spA_C
Plasmid#135978PurposegRNA against the right loxP site of the Ai9 alleleDepositorInsertAi9 gRNA2
UseAAV, CRISPR, and Mouse TargetingTagsHAExpressionMutationPromoterCBAvailable sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-dSaCas9-KRAB-T2A-PuroR
Plasmid#106249PurposeLentiviral vector with puro selection for expression of S. aureus dCas9-KRABDepositorInsertdead S. aureus Cas9 KRAB T2A PuroR
UseCRISPR and LentiviralTagsHA-NLS and NLS-KRABExpressionMammalianMutationD10A and N580APromoterhUbCAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV_hU6-sgRNA_hUbC-dSaCas9-KRAB-T2A-PuroR
Plasmid#162334PurposeLentiviral expression of dSaCas9-KRAB and a sgRNA with puromycin resistanceDepositorInsertdSaCas9-KRAB
UseLentiviralTagsHAExpressionMammalianMutationPromoterhUbCAvailable sinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty Cassette
Plasmid#113693PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. SapI can be used to clone in gRNAs.DepositorInsertSaCas9 gRNA Cassete
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-Lyso-FLAG-GFP-Sac1-Cat-WT
Plasmid#134645Purposelysosome-targeted Sac1 catalytic domain wild typeDepositorInsertSac1 catalytic domain (77-520 aa) (SACM1L Human)
UseLentiviralTagsFLAG, GFP, and lysosomal-tag (p18 N-terminal 1-39…ExpressionMammalianMutationcontains only amino acids 77-520 (Please see depo…PromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
NdeI – SacII – SpeI(NheI) - ANXA2 (23-339)
Plasmid#136543PurposeExpresses ANXA2 chimeras in bacterial cellsDepositorTypeEmpty backboneUseTagsANXA2 (23-339) and His-tagExpressionBacterialMutationPromoterAvailable sinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-Lyso-FLAG-GFP-Sac1-Cat-CS
Plasmid#134653Purposelysosome-targeted Sac1 catalytic domain C389SDepositorInsertSac1 catalytic domain (77-520 aa) CS mutant (SACM1L Human)
UseLentiviralTagsFLAG, GFP, and lysosomal-tag (p18 N-terminal 1-39…ExpressionMammalianMutationC389S and contains only amino acids 77-520 (Pleas…PromoterAvailable sinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP160-pU6-sgRNA
Plasmid#158987PurposeVector D encodes pAAV-pMecp2-dSaCas9-VP160-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP160
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpMecp2Available sinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFS_0271_pET30_pCat-tetR-Term-ptetA-sfGFP-rrnBterm_Fusicatenibacter_saccharivorans_ARRAY2_FaqI
Plasmid#116955PurposeExpresses FsRT-Cas1-Cas2 under pT7lac and sfGFP under ptetA promoter, encodes FsCRISPR array 2, compatible with SENECA acquisition readoutDepositorInsertFusicatenibacter saccharivorans RT-Cas1-Cas2
UseTagsExpressionBacterialMutationPromoterT7Available sinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP309-pAAV-EFS-dSaCas9-KRAB-Dio-pA
Plasmid#113686PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription repressor KRAB. dSaCas9-KRAB is floxed to render the system cre-dependent.DepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Cre/LoxTagsKRABExpressionMutationPromoterAvailable sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP308-pAAV-EFS-dSaCas9-VP64-Dio-pA
Plasmid#113685PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription activator VP64. dSaCas9-VP64 is floxed to render the system cre-dependent.DepositorInsertinverted de-catalyzed SaCas9
UseAAV, CRISPR, Cre/Lox, and Synthetic BiologyTagsNLS and VP64ExpressionMutationPromoterAvailable sinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
1781_pAAV-U6-Ai9-Sa-gRNA1-CB-SACas9-HA-OLLAS-spA_C
Plasmid#135979PurposegRNA against the left loxP site of the Ai9 alleleDepositorInsertAi9 gRNA1
UseAAV, CRISPR, and Mouse TargetingTagsHAExpressionMutationPromoterU6Available sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-Scaffold-cTNT-SaCas9-HA-OLLAS
Plasmid#209781PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA scaffold by U6 promoterDepositorInsertcTNT
UseAAVTagsHA and OLLASExpressionMutationPromotercTNTAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-OLLAS
Plasmid#209782PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoterDepositorInsertsgRNA
UseAAVTagsHA and OLLASExpressionMutationPromotercTNTAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-SacB-Cas9-T2A-mCherry_(BbsI)
Plasmid#117070PurposeEncodes Cas9, T2A-mCherry, and AmpR which creates a CRISPR system application with reliable positive selectionDepositorInsertsCas9
SacB
UseCRISPRTags3x FLAG, NLS, and T2A-mCherryExpressionMammalianMutationPromoterCBh and U6Available sinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only