We narrowed to 24,612 results for: crispr
-
Plasmid#46911PurposeHuman expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS, tagBFP and a KRAB domainDepositorInsertdCas9-BFP-KRAB fusion
UseCRISPR and LentiviralTags2xNLS, BFP, HA, and KRAB domainExpressionMammalianPromoterSFFVAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP
Plasmid#60955PurposeParental vector for the CRISPRi/a libraries. Expresses an sgRNA from the U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoterDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA
Plasmid#47108PurposeExpresses a S. pyogenes Cas9/dCas9 guide RNA in mammalian cellsDepositorHas ServiceCloning Grade DNAInsertSPgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eA3A-BE5-(NG)-PX458-EGFP
Plasmid#229687PurposeCRISPR CBE plasmid (C to T edits): eA3A-BE5-NG engineered to include the sgRNA cloning backbone from PX458 and EGFP. Includes BbsI sites for sgRNA cloning downstream of U6 promoter.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
VE-cad KI gRNA1
Plasmid#92310PurposeCRISPR-GFP-gRNA for cutting VEcadDepositorAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
VE-cad KI gRNA2
Plasmid#92311PurposeCRISPR-GFP-gRNA for cutting VEcadDepositorAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pY108 (lenti-AsCpf1)
Plasmid#84739PurposeLenti virus delivery of AsCpf1 and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pY095
Plasmid#84744PurposeExpresses huLbCpf1-T2A-GFP and crRNA guideDepositorInsertshuLbCpf1
GFP
UseCRISPRTags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1651-sgTelomere(F+E)
Plasmid#51024PurposeLentiviral vector that contains an optimized S. pyogenes sgRNA targeting human telomeresDepositorInsertOptimized sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6 promoterAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
gRNA-CXCR4(90)
Plasmid#98962PurposeMammalian expression plasmid for CRISPR gRNA targeting human CXCR4 exon 2DepositorInsertCXCR4 (CXCR4 Human)
UseCRISPRExpressionMammalianMutationEncodes a gRNA for CRISPR-mediated targeting of C…PromoterU6Available SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cas12aUltra_5XNLS
Plasmid#218775PurposeHis-TEV-Cas12aUltra-BPSV40_cMyc_NP_5NLSDepositorInsert5xNLS-BPSV40-NLP-cMyc-cMyc-BPSV40- AspCas12a
UseCRISPRTags6XHis (C terminal), HA, Nucleoplasmin, SV40, and …ExpressionBacterialMutationNucleotides mutations were made to encode for arg…Available SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiBE3-SpRY-Blast
Plasmid#199303PurposeExpresses SpRY Cas9 nickase cytosine base editor FNLS-BE3 and blasticidin resistanceDepositorInsertFNLS-BE3-SpRY
UseCRISPR and LentiviralTags2A tagExpressionMammalianPromoterEFSAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pY094
Plasmid#84743PurposeExpresses huAsCpf1-T2A-GFP and crRNA guideDepositorInsertshuAsCpf1
GFP
Tags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRDB_054
Plasmid#216096PurposeAll-in-one, knockout, delivers Cas12a & gRNADepositorInsertCas12a [EnAs]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP
Plasmid#64216PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked to BFP via a T2A peptideDepositorInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFPExpressionMammalianPromoterCBh and U6Available SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187951PurposeFKBP12 (F36V mutant) degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-dCas9-KRAB-PGK-HygR
Plasmid#83890PurposeLentiviral Sp dCas9-KRAB fusion with Hygromycin B resistance cassette.DepositorInsertshumanized dead Cas9 KRAB
aminoglycoside phosphotransferase from E. coli
UseCRISPR and LentiviralTagsFlagMutationD10A and H840APromoterHuman Ubiquitin C Promoter and mouse phosphoglyce…Available SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-SpG-P2A-EGFP (RTW4562)
Plasmid#140002PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpG(D10A/D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpG with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpG=D1135L/S1136W/G1218K/E1219Q/R13…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX458-DsRed2
Plasmid#112219PurposeCloning backbone for sgRNA, co-expresses human optimized S. pyogenes Cas9 and DsRed2DepositorInsertDsRed2
UseCRISPRExpressionMammalianMutationDsRed2 contains a silent nucleotide substitution …Available SinceJuly 11, 2018AvailabilityAcademic Institutions and Nonprofits only