We narrowed to 10,107 results for: transfer
-
Plasmid#137148PurposeIntersectional viral expression of Arch3.3-EYFP in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-Arch3.3-p2a-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-sCreDIO hChR2(H134R)-EYFP
Plasmid#55642PurposesCre-Dependent ChR2-EYFPDepositorInserthChR2(H134R)-EYFP
UseAAV; Scre-dependentTagsEYFPExpressionMammalianPromoterEf1aAvailable SinceAug. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
scAAV-Mlc2v-MPRA
Plasmid#182649PurposeSelf complementary AAV vector for high-throughput in vivo measurement of enhancer activity by massively parallel reporter assayDepositorInsertmCherry
UseAAVExpressionMammalianPromoterrat Mlc2vAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ96 AAV-SpABE8e-N-terminus_tracrRNA
Plasmid#211817PurposeAAV vector expressing N-terminal of SpCas9-ABE8e and tracrRNADepositorInsertN-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ100 AAV-SpABE8e-C_terminus-tracrRNA
Plasmid#211818PurposeAAV vector expressing C-terminus of SpCas9-ABE8e with tracrRNADepositorInsertC-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-oScarlet
Plasmid#137137PurposeIntersectional viral expression of oScarlet in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE95DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.SF-iGluSnFR.A184V.mRuby3
Plasmid#106205PurposeMedium affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-iGluSnFR.A184V
UseAAVMutationGltI: A184V + mRuby3 fusionPromoterCAGAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2-EYFP
Plasmid#137163PurposeIntersectional viral expression of ChR2-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-ChR2-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationH134RPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-C2m2-SNAP
Plasmid#208791PurposeFor AAV production to express C2m2-SNAP in astrocytesDepositorInsertC2m2-SNAP (Mfge8 Mouse)
UseAAVTagsSNAP-tagExpressionMammalianMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterGFAP promoterAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-sRGECO
Plasmid#137127PurposeIntersectional viral expression of sRGECO in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-sRGECO
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE217DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-miRFP-6xFLAG
Plasmid#161614PurposeCell morphology marker construct. Contains a near infrared fluorescent protein miRFP and six FLAG tags.DepositorInsertmiRFP-6xFLAG
UseAAVExpressionMammalianMutationN/APromoterHuman synapsin 1 promoterAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL
Plasmid#217676PurposeAAV-mediated, Cre-dependent co-expression of GtACR2 and soma-targeted Voltron2 (ORCHID) for assessing inhibitory receptor driving force through voltage imaging with concurrent activation of GtACR2.DepositorHas ServiceAAV1InsertGtACR2-P2A-Voltron2ST
UseAAVTagsSoma targeting sequence (Kv2.1) on Voltron2 gene …ExpressionMammalianPromoterEF‐1αAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV312.3
Plasmid#119944PurposeExpresses C-terminal Npu DnaE Intein-SaKKH-BE3, tagRFP, and sgRNA in mammalian cellsDepositorInsertC-Intein (Npu DnaE) - C-terminal (740)SaKKH-BE3
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceMay 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-Lambda2
Plasmid#104184PurposeLentiviral transfer vector that carries U6-driven non-targeting sgRNA using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-sgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-TM-Kv2.1-CaM-NES-TevN-AsLOV2-TEVseq-tTA
Plasmid#171618PurposeAAV Soma-targeted Cal-Light with Kv2.1DepositorInsertTM-Kv2.1-CaM-NES-TevN-AsLOV2-TEVseq-tTA
UseAAV and Synthetic BiologyTagsMycExpressionMammalianPromoterCMVAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV_Nanog HMEJ donor
Plasmid#97321PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Nanog. AAV backbone.DepositorInsertNanog HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE C-terminal
Plasmid#137183PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-saCBE C-terminal
UseAAVPromoterCbhAvailable SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-ChR2-mCherry
Plasmid#137144PurposeIntersectional viral expression of ChR2-mCherry in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-ChR2-mCherry
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationH134RPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only