We narrowed to 6,896 results for: tet
-
Plasmid#164204PurposeExpresses CRY2oligo-mcherry tagged ANXA11 D40G mutant under CMV promoterDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only
-
KA2880_pPB-TREtight-FLAG-Esrrb-InO
Plasmid#124178PurposepiggyBac-based Dox-inducible expression of FLAG-EsrrbDepositorAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-CCND1shRNA2
Plasmid#220578PurposeTo inducibly knockdown CCND1 expressionDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
Gal4-entry+NLS
Plasmid#128013PurposeVector containing the Gal4-entry expression cassette with SV40 NLS and a separate expression cassette driving mCherry via the traffic jam enhancerDepositorInsertGal4 DBD-SV40NLS-3x-Flag
UseGal4 entry vector with nls to generate tethering …TagsGal4-DBD-SV40NLS-3xFlagAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
HL 818 (=HL 716 + pHL 98)
Plasmid#30006DepositorInsertpLlacO-1:DsrA-mcherry, pLtetO-1:rpoS::gfp
UseSynthetic BiologyTagsmcherry, GFPExpressionBacterialAvailable SinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-sec:msfGFP
Plasmid#194914PurposeTetracycline inducible expression of msfGFP fused to Sec signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Sec signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-tat:msfGFP
Plasmid#194915PurposeTetracycline inducible expression of msfGFP fused to Tat signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Tat signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-MAFF
Plasmid#192917PurposeBarcoded piggybac transposon vector with Dox-inducible expression of MAFFDepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMX-53BP1(1-1710) 3LA
Plasmid#185698PurposeMammalian Expression, Retroviral vector that encodes a 3LA mutant of 53BP1 that disrupts three RIF1-binding motifs and abolishes the 53BP1-dependent recruitment of RIF1 to DNA double-strand breaks.DepositorInsert53BP1(1-1710) 3LA (TP53BP1 Human)
UseRetroviralTagsFlag tag, HA tag, and tetracysteine tagExpressionMammalianMutationL175A, L517A, and L693APromoterSV40Available SinceJuly 7, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRS423-mitoT
Plasmid#174525PurposeExpresses yeast variant of mitoT synthetic intermembrane tether bridging the inner and outer mitochondrial membranesDepositorInsertYeast mitochondrial intermembrane tether
UseSynthetic BiologyTagseGFPExpressionYeastPromoterMET25Available SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-NHA-Ago2
Plasmid#115361PurposeExpression vector to produce NHA-tagged human Ago2 proteinDepositorAvailable SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
p5A0-T
Plasmid#92016PurposeExpresses TALE targeted to lac operator without TEV cut sites, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VPromoterJ23102 Promoter (from Anderson promoter library) …Available SinceJan. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-KNL1-rvsf_aaaa-dCas9
Plasmid#248567PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertKNL1-rvsf_aaaa-dCas9
UseCRISPRTagsHA, 2xNLSExpressionMammalianMutationKNL1 RVSF58-61AAAA; Cas9 D10A, H840APromoterCMV, TetO2Available SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-bioGEF-SUMO2nc-PURO
Plasmid#208043PurposeEnables inducible expression of low-affinity Avitag-SUMO2nc; to perform bioE3; nc = non-cleavable mutation; selection with puromycinDepositorInsertSUMO2nc (SUMO2 Human)
UseLentiviralTagsLow-affinity AvitagMutationQ90P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-NR1H2
Plasmid#192919PurposeBarcoded piggybac transposon vector with Dox-inducible expression of NR1H2DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-WT1
Plasmid#192906PurposeBarcoded piggybac transposon vector with Dox-inducible expression of WT1DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-bioGEF-SUMO1nc-PURO
Plasmid#208042PurposeEnables inducible expression of low-affinity Avitag-SUMO1nc; to perform bioE3; nc = non-cleavable mutation; selection with puromycinDepositorInsertSUMO1nc (SUMO1 Human)
UseLentiviralTagsLow-affinity AvitagMutationQ94P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMX-53BP1(1-1710) 3LA7A
Plasmid#185707PurposeMammalian Expression, Retroviral vector that encodes 7A and 3LA mutant of 53BP1. Prevents shieldin and RIF1 recruitment to sites of double-strand breaks and disrupts 53BP1 activity.DepositorInsert53BP1(1-1710) 3LA7A (TP53BP1 Human)
UseRetroviralTagsFlag tag, HA tag, and tetracysteine tagExpressionMammalianMutationT302A, S452A, S523A, S543A, S625A, S784A, and S89…PromoterSV40Available SinceJuly 1, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
p5072 pcDNA4c hBrd4 (1224-1362)
Plasmid#14451DepositorAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only