We narrowed to 40,765 results for: kan
-
Plasmid#69941PurposepSTC2,theoHHAzRaj12,cisRaj11-sfGFP, KanRDepositorInsertTheoHHAzRaj12,cisRaj11,sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSCKtheoRaj12-olsa
Plasmid#69940PurposepSTC2,theoHHAzRaj12,cisRaj12-sfGFP, KanRDepositorInsertsTheoHHAzRaj12,cisRaj12,sfGFP
theoHHAzRaj12,cisRaj12-sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
Triple mutant
Plasmid#63719PurposeVoltage sensing domain of Ciona with the A154D/R217Q/R229I mutations fused to super ecliptic pHlorin A227DDepositorInsertTriple mutant
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
CC6
Plasmid#63718PurposeVoltage sensing domain of Ciona with the D136S/R168H/T193P/V220R mutations fused to super ecliptic pHlorin A227DDepositorInsertCC6
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
CC5
Plasmid#63717PurposeVoltage sensing domain of Ciona with the D129N/D164N/G187A/V220T mutations fused to super ecliptic pHlorin A227DDepositorInsertCC5
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
CC4
Plasmid#63716PurposeVoltage sensing domain of Ciona with the D129S/R168A/D186S/R229I mutations fused to super ecliptic pHlorin A227DDepositorInsertCC4
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
CC2
Plasmid#63714PurposeVoltage sensing domain of Ciona with the D136A/A154D/E183N/R223Q mutations fused to super ecliptic pHlorin A227DDepositorInsertCC2
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSMART-Ala1
Plasmid#65814PurposeNADPH dependent Alanine Dehydrogenase, Low Phosphate Dependent E. coli ExpressionDepositorInsertNADPH Alanine Dehydrogenase (ald Synthetic)
ExpressionBacterialMutationD196A, L197RPromoterInsulated waaHp from E. coliAvailable SinceJuly 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
CC3
Plasmid#63715PurposeVoltage sensing domain of Ciona with the G122A/D164A/D186A/R217Q/R229I mutations fused to super ecliptic pHlorin A227DDepositorInsertCC3
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGAD-hPLEKHM1
Plasmid#64145PurposeFor yeast two hybridDepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGMCK-0X750-luxAB-DAS+4
Plasmid#49517PurposeKanamycin resistant; expresses luxAB-DAS+4 under the control of a promoter containing PtetO-4C5G; integrates into the mycobacteriophage att-L5 siteDepositorInsertP750-luxAB-DAS+4
TagsDAS+4 (AANDENYSENYADAS)ExpressionBacterialPromoterP750Available SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
CFP-GAI(1-151)
Plasmid#37308DepositorAvailable SinceJune 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
ML14
Bacterial Strain#61911PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. tyrA gene deleted.DepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
ML17
Bacterial Strain#61912PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. glnA gene deleted.DepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV mGAD65(delE1) GFP WPRE SV40pA
Plasmid#177316PurposeTo produce the AAV vector that expresses GFP under the control of the mGAD65 promoter. The mGAD65 promoter has highly specificity to GABAergic interneurons.DepositorInsertmGAD65(delE1) promoter, GABAergic interneurons specific promoter
UseAAVAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1363 LV EF1a-CD19 IRES-EGFP
Plasmid#201919Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD19DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_Luciferase
Plasmid#25894PurposeGateway entry vector containing Luciferase.DepositorInsertLuciferase
UseGateway entry vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAM4891 (pCV0003)
Plasmid#120080PurposeBroad host range plasmid. Bacteria plasmid vector to test various parts and devices. Expression of GFP and a Kanamycin/Neomycin resistance gene in various cyanobacteria.DepositorInsertPlasmid assembled from 3 CYANO-VECTOR modular devices: CV-RSF1010Y25F, CV-aph1, CV-PconII-LTRBS-GFPmut2
UseOtherMutationmobA Y25FAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBNde(min)
Plasmid#15125DepositorAvailable SinceMarch 5, 2012AvailabilityAcademic Institutions and Nonprofits only