We narrowed to 19,820 results for: INO
-
Plasmid#224414PurposeMammalian expression of MARK2DepositorAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only
-
SNX10-PX (1-201)
Plasmid#119091PurposeBacterial expression of human phox homology (PX) domain, SNX10-PX (1-201)DepositorAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT_CMV_NES-Caprola_off-mEGFP
Plasmid#194687PurposeCMV driven expression of the inactive calcium recorder negative control Caprola_off in mammalian cell lines fused to mEGFPDepositorInsertCaprola_off-mEGFP
TagsmEGFPExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-OsTIR1(F74A)
Plasmid#140731PurposeOsTIR1(F74A)-P2A-mAID-EGFP-NESDepositorInsertOsTIR1(F74A)-P2A-mAID-EGFP-NES
UseAAVExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRSETb-pcDronpa2-A69T
Plasmid#98578Purposephotoconvertible fluorescent protein pcDronpa2-A69T in pRSetB plasmid, photoconvertible by primed conversion mechanism, bacterial overexpressionDepositorInsertpcDronpa2-A69T
Tags6xHisExpressionBacterialPromoterT7Available SinceMarch 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
NLS-AgDD
Plasmid#80625Purposecreate nuclear protein aggregates in mammalian cellsDepositorAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
896 pcDNA3 T7 Akt1
Plasmid#9003DepositorInsertAkt1 (AKT1 Human)
ExpressionMammalianAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
anti-FX(a) Emi HC
Plasmid#113665PurposeFor transient expression of Emicizumab sequence (CAS# 1610943-06-0, KEGG# D10821), IgG4 bispecific antibody targeting FIX(a) & FX(a). Must be co-expressed with the anti-FIX(a) Emi HC and the Emi LC.DepositorInsertEmicizumab anti-FX/FXa heavy chain
ExpressionMammalianPromoterCMV PromoterAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGB1alpha11_SulR
Plasmid#186424Purposetranscriptional unit for sulfadiazine resistance; plant expression driven by the Pnos promoter; suitable for quintuple assemblyDepositorInsertSulR
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMA3379
Plasmid#46874PurposeA lentiviral vector for the doxycycline-inducible expression of soluble guanylate cyclase1 alpha3DepositorAvailable SinceDec. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMK427 (OsTIR1(WT) mAID-EGFP-Nluc)
Plasmid#140658PurposeOsTIR1(WT)-P2A-mAID-EGFP-NlucDepositorInsertOsTIR1(WT) mAID-EGFP-Nluc TOL2
ExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pY31
Plasmid#84746PurposeExpresses huLbCpf1-P2A-puro and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseCRISPRTags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-cGAS-N-HA
Plasmid#130913PurposeExpresses human cGAS N terminus(aa1-159)-HA; Puromycin selection markerDepositorInsertcGAS N terminus
TagsHAExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
P2RX1-bio-His
Plasmid#53359PurposeExpresses full-length P2X purinoceptor 1 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertP2RX1 (P2RX1 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 2xFLAG-2xSTREP TFDP1
Plasmid#236444Purposetransient overexpression of TFDP1 in mammalian cellsDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
anti-FIX(a) Emi HC
Plasmid#113664PurposeFor transient expression of Emicizumab sequence (CAS# 1610943-06-0, KEGG# D10821), IgG4 bispecific antibody targeting FIX(a) & FX(a). Must be co-expressed with the anti-FX(a) Emi HC and the Emi LC.DepositorInsertEmicizumab anti-FIX/FIXa heavy chain
ExpressionMammalianPromoterCMV PromoterAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOGG043
Plasmid#133123PurposeLevel 0 PU module synthesised as a fragment (pL0M-PU-PsNifH). Synthetic consensus promoter to drive nodule-specific expression in biovars and strains of R. leguminosarum.DepositorInsertPsNifH Synthetic consensus nifH promoter
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV2_hSyn_NES-Caprola_06-mEGFP_WRPE-SV40
Plasmid#194690PurposehSyn1 driven expression of the calcium recorder Caprola_06 fused to mEGFP for neuronal expression through AAV transductionDepositorInsertCaprola_06-mEGFP
UseAAVTagsmEGFPPromoterhSyn1Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBp-FGFR3c-WT
Plasmid#45711DepositorAvailable SinceJune 11, 2013AvailabilityAcademic Institutions and Nonprofits only