We narrowed to 14,531 results for: TIM
-
Plasmid#190822PurposeFor expression of the TPR domain of human ncOGT (C467X mutation) in E.coli. The ncOGT is 6x His-tagged on its N-terminus and codon-optimized for E.coli.DepositorInsertO-GlcNAc Transferase (OGT Human)
Tags6x HisExpressionBacterialMutationC467X. Also codon optimized for expression in E.c…PromoterT7Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
PRKAA1 gRNA (BRDN0001146526)
Plasmid#76253Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYFP-ErbB2ΔC776
Plasmid#66947PurposeMammalian expression of rat ErbB2 ΔC776 tagged with YFPDepositorInsertErbB2 (Erbb2 Rat)
Tags6xHis, V5 Tag, and YFPExpressionMammalianMutationDeletion of C776 (see depositor comment below on …PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
PIKFYVE gRNA (BRDN0001148075)
Plasmid#76891Purpose3rd generation lentiviral gRNA plasmid targeting human PIKFYVEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK4 gRNA (BRDN0001147987)
Plasmid#76075Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLIK JunD-HA neo
Plasmid#58515PurposeLentiviral expression vector for an inducible HA-tagged mouse JunDDepositorAvailable SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1C gRNA (BRDN0001148198)
Plasmid#77665Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1C gRNA (BRDN0001145736)
Plasmid#77666Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RIPK1 gRNA (BRDN0001148444)
Plasmid#76533Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RIPK1 gRNA (BRDN0001149461)
Plasmid#76532Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK4 gRNA (BRDN0001149002)
Plasmid#76074Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIKFYVE gRNA (BRDN0001148312)
Plasmid#76893Purpose3rd generation lentiviral gRNA plasmid targeting human PIKFYVEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorT(sp)-mNeonGreen
Plasmid#205021PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorT signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorT-mNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(Δ71)-mCherry
Plasmid#92425PurposeExpression of fusion incompetent VAMP3 (del71) C-terminally conjugated to mCherry.DepositorInsertVAMP3 (Vamp3 Mouse)
TagsmCherryExpressionMammalianMutationdeleted leucine 71PromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-tagBFP-TetR
Plasmid#103797PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-dSpCas9-HF1-VP64-6xHis
Plasmid#92118PurposeExpression of dead/inactive increased fidelity SpCas9-HF1-VP64-6xHis in bacterial cellsDepositorInsertdead/inactive SpCas9-HF1-NLS-3xFLAG-VP64
UseCRISPRTags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A, N497A, R661A, Q695A, H840A, Q926APromoterT7Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1C gRNA (BRDN0001145164)
Plasmid#77667Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
RIPK1 gRNA (BRDN0001146967)
Plasmid#76534Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only