We narrowed to 10,024 results for: CAG
-
Plasmid#85488PurposeFirefly luciferase under the control of NDUFS6 5'UTRDepositorAvailable SinceFeb. 21, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1puro-shWillin-A
Plasmid#40885DepositorAvailable SinceNov. 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMT1E-2
Plasmid#251691PurposegRNA to knock out MT1E in mammalian cellsDepositorInsertMT1E metallothionein 1E (MT1E Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMT1X-1
Plasmid#251692PurposegRNA to knock out MT1X in mammalian cellsDepositorInsertMT1X metallothionein 1X (MT1X Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shAtg7-EGFP
Plasmid#227684PurposeExpresses EGFP and shRNA targeting Atg7DepositorInsertAtg7 shRNA (Atg7 Mouse)
ExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d sgCiPELO #8
Plasmid#228934PurposeExpression of dCas9-KRAB and sgRNA targeting PELODepositorInsertPELO gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pColdI-SBP-DDX3_helicase_core
Plasmid#233622PurposeExpression of SBP-tagged helicase core region of DDX3X in E.coliDepositorAvailable SinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2 PQBP1 KO1
Plasmid#217447PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human PQBP1DepositorAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-2
Plasmid#230084PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-3
Plasmid#230085PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2703-AGER-gRNA2
Plasmid#216472Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(PRDM14_v32_7-6)-PGKpuroBFP-W
Plasmid#211983PurposeExpress gRNA against PRDM14 with puro and BFPDepositorInsertsgRNA targeting PRDM14 (PRDM14 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ACIN1_sgRNA2
Plasmid#201589PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertACIN1 (ACIN1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #1
Plasmid#198759Purposeconditional knockdown of FDPSDepositorInsertshFDPS #1 (FDPS Human)
ExpressionMammalianAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.1_puro_shJUND #1
Plasmid#136581PurposeExpresses an inducible short hairpin targeting human JUND sequenceDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Flnc
Plasmid#174870PurposeCRISPR vector for generating Flnc STREAMING-tag KI cellDepositorInsertsgRNA for mouse Flnc (Flnc Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSpen#2/Cre
Plasmid#193240PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgUbr5#2/Cre
Plasmid#173624PurposeExpresses a Ubr5-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ubr5 (Ubr5 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf1#1/Cre
Plasmid#173607PurposeExpresses a Nf1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf1 (Nf1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only