We narrowed to 11,479 results for: AGA
-
Plasmid#193240PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only
-
Lenti-sgTnr#1/Cre
Plasmid#193244PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgZfp536#2/Cre
Plasmid#193249PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Zfp536 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5-STABLE2-neo-RvCAHS3
Plasmid#192472PurposeStable expression of RvCAHS3 (fly codon optimized) in Drosophila cellsDepositorInsertCAHS3
TagsT2A-EGFP-T2A-neoRExpressionInsectPromoterAc5 promoterAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-DSP
Plasmid#185549PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting DSPDepositorInsertDSP gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_219
Plasmid#180534PurposeEntry vector containing K.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_223
Plasmid#180538PurposeEntry vector containing K.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
ppil2.280.457.Y389H
Plasmid#137658PurposeExpresses N-terminal (His)6-Thrombin cleavage site fusion of human gene or portion of gene with point mutation in bacterial strains. pET based vector.DepositorAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
ppil2.280.457.Y389W
Plasmid#137657PurposeExpresses N-terminal (His)6-Thrombin cleavage site fusion of human gene or portion of gene with point mutation in bacterial strains. pET based vector.DepositorAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_226
Plasmid#180552PurposeEntry vector containing K.rhaeticus native promoter pRutB (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pRutB (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRnf43#2/Cre
Plasmid#173614PurposeExpresses a Rnf43-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Rnf43 (Rnf43 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
TKIT NFL gRNA1 gRNA2
Plasmid#182681PurposeExpression of spCas9, gRNA targeting intron 3 and gRNA targeting 3'UTR of the mouse Nefl gene. Can be used for the tagging of endogenous NFL via Targeted Knock-In with Two guides (TKIT) approach.DepositorInserttwo Nefl-targeting gRNAs, one targets intron 3 and the other 3'UTR of the Nefl gene (Nefl Mouse)
UseCRISPRExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_218
Plasmid#180533PurposeEntry vector containing K.rhaeticus native promoter pTtaC (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pTtaC (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_225
Plasmid#180539PurposeEntry vector containing K.rhaeticus native promoter pBlh (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pBlh (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_221
Plasmid#180536PurposeEntry vector containing K.rhaeticus native promoter pKr0953 (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pKr0953 (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_220
Plasmid#180535PurposeEntry vector containing K.rhaeticus native promoter pAacsAB4 (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pAacsAB4 (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_222
Plasmid#180537PurposeEntry vector containing K.rhaeticus native promoter pCyd (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pCyd (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon8
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only