We narrowed to 14,500 results for: TIM
-
Plasmid#50723Purposeoverexpression of human TPI1 in E.coliDepositorAvailable SinceJan. 30, 2014AvailabilityAcademic Institutions and Nonprofits only
-
miniCMV-iRFP670-24xMS2
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413GPD-hTPI
Plasmid#50719Purposeexpression of human TPI1 in yeastDepositorAvailable SinceJan. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
p413GPD-hTPI Ile170Val
Plasmid#50720Purposeexpression of the human TPI Ile170Val allele in yeastDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
ExpressionYeastMutationIsoleucine 170 to ValinePromoterGPDAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
p413GPD-hTPI Ile170Thr
Plasmid#50721Purposeexpression of the human TPI Ile170Thr allele in yeastDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
ExpressionYeastMutationIsoleucine 170 to ThreoninePromoterGPDAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
C321.∆A.opt
Bacterial Strain#87359PurposeThis is C321.∆A with additional mutations engineered by Kuznetsov et al. to improve doubling time.DepositorBacterial ResistanceGentamicinSpeciesSyntheticAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Ubc-iRFP670-24xMS2-24xPP7
Plasmid#238916PurposeContains Ubc promoter expressing iRFP670 mRNA taged 24xMS2 motif and 24xPP7 motifDepositorInsertiRFP670-24xMS2-24xPP7
UseLentiviralExpressionMammalianPromoterUbcAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET20b- hTPI Lys13Arg
Plasmid#50726Purposeoverexpression of the human TPI1 Lys13Arg allele in E.coliDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
Tags6xHIS tagExpressionBacterialMutationchanged Lysine 13 to ArgeninePromoterT7Available SinceFeb. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
p3.2mar-GFP
Plasmid#63694Purpose3.2 kb marine armor plate enhancer driving GFP reporterDepositorInsert3.2 kb marine stickleback armor plate enhancer
TagsEGFPExpressionMammalianPromoterhsp70Available SinceApril 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET20b- hTPI Ile170Val
Plasmid#50724Purposeoverexpression of the human TPI1 Ile170Val allele in E.coliDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
Tags6xHIS tagExpressionBacterialMutationchanged Isoleucine 170 to ValinePromoterT7Available SinceJan. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
p413GPD-hTPI Lys13Arg
Plasmid#50722Purposeexpression of the human TPI Lys13Arg allele in yeastDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
ExpressionYeastMutationchanged Lysine 13 to ArgeninePromoterGPDAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET20b- hTPI Ile170Thr
Plasmid#50725Purposeoverexpression of the human TPI1 Ile170Thr allele in E.coliDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
Tags6xHIS tagExpressionBacterialMutationchanged Isoleucine 170 to ThreoninePromoterT7Available SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
EcM2.1
Bacterial Strain#64052PurposeOptimized strain for high-efficiency genome manipulations using CoS-MAGE and tolC cyclingDepositorBacterial ResistanceAmpicillinAvailable SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
EcM2.1.dtolC
Bacterial Strain#64053PurposeOptimized strain for high-efficiency genome manipulations using CoS-MAGE and tolC cyclingDepositorBacterial ResistanceAmpicillinAvailable SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
EcM2.1 dtolC bla::zeoR
Bacterial Strain#64054PurposeOptimized strain for high-efficiency genome manipulations using CoS-MAGE and tolC cyclingDepositorBacterial ResistanceBleocin (Zeocin)Available SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
FD1
Bacterial Strain#125258PurposeDerivative of MG1655 used for the screening of clones able to survive the bad seed toxicity of dCas9, while still efficiently silencing the expression of mcherryDepositorBacterial ResistanceNoneAvailable SinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAL190
Plasmid#22279PurposeExpresses Tim DH-PH domains fused to mYFP-PIF6, for optogenetic recruitmentDepositorInsertTimDHPH-20aaLinker-mYFP-PIF6APB (PIL2 Mustard Weed)
UseSynthetic BiologyExpressionMammalianPromoterSV40Available SinceOct. 21, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCR197
Plasmid#240643PurposeExpression of the tri-cistronic construct NES-AmNeonGreen-P2A-mTurquoise2-NLS-T2A-mScarlet-I-PTS1 in Exaiptasia diaphana; In vitro transcription of the same construct via SP6 polymeraseDepositorInsertsAIPGENE865 promoter
SP6 promoter
AmNeonGreen
mTurquoise2
mScarlet-I
UseGene expression and genomic integration in fishTagsNES (from Exaiptasia diaphana MEK2), NLS (from SV…MutationCodon-optimized for Exaiptasia diaphana, amino ac…Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TPI in pCW57_tTA_Blast
Plasmid#154209PurposeDox-off lentivirus construct all-in-one vector, with Blast resistance, for expression of TPIDepositorInsertTPI1 (TPI1 Human)
UseLentiviralTagsNoneExpressionMammalianPromoterTRE repeats (dox off)Available SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
TPI-PTC160
Plasmid#130698PurposeExpresses TPI-PTC160 NMD reporter (It has a Premature termination codon (PTC) at 160th Amino acid)DepositorAvailable SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only