We narrowed to 7,396 results for: GFP expression plasmids
-
Plasmid#247437PurposeHA-tagged human RhoA(G14V) cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorInsertsUseLentiviral; Dox-inducibleTagsHAExpressionMammalianMutationG14V mutation (constitutive active mutant)Available SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pCW-CDK1-HA
Plasmid#247438PurposeHA-tagged mouse CDK1 cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-CKS2-HA
Plasmid#247439PurposeHA-tagged mouse CKS2 cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-Myoferlin-HA
Plasmid#247440PurposeHA-tagged human Myoferlin cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorInsertsUseLentiviral; Dox-inducibleTagsHAExpressionMammalianAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT4
Plasmid#127513PurposePlasmid encodes H. sapiens codon optimized Integrase 4.DepositorInsertIntegrase 4 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT5
Plasmid#127514PurposePlasmid encodes H. sapiens codon optimized Integrase 5.DepositorInsertIntegrase 5 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AP682-1
Plasmid#70050PurposeExpresses TEV::eGFP::myc::3Xflag in bacteriaDepositorInserteGFP
TagsTEV and myc::3XflagExpressionBacterialAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBA2675
Plasmid#189997PurposeInducible expression of FBP75 (1–200)-NLS-VhhGFP4, integrate at 177 bp, phleomycin marker (deGradFP for nuclear proteins)DepositorInsertsFBP75
VhhGFP4
UseExpression vector for trypanosoma bruceiTagsNLSMutationN-terminal 600 bp of FBP75Available SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBA2705
Plasmid#189998PurposeInducible expression of FBP75(1–200)-VhhGFP4, integrate at 177 bp, phleomycin marker (deGradFP for cytoplasmic proteins)DepositorInsertsFBP75
VhhGFP4
UseExpression vector for trypanosoma bruceiMutationN-terminal 600 bp of FBP75Available SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEMS1424
Plasmid#29220PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertPle155-EGFP-NLS
UseHigh copy number homologous recombination plasmid…ExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pKM493
Plasmid#140191PurposeORBIT integrating plasmid for C-terminal tagging with cleavable EGFP.DepositorInsertTEV-Flag-Gly4-eGFP
TagsFlag + eGFPExpressionBacterialPromoterPGroELAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM162
Plasmid#173221PurposeExpresses ScFV-GCN4-GFP10M2-GB1-T2A-OptGFP(1-9)-GB1 and Puro-T2A-MCP-mCherry-GFP11-GB1DepositorInsertsScFV-GCN4-GFP10M2-GB1-T2A-OptGFP (1-10)-GB1
MCP-mCherry-GFP11-GB1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBD21_035
Plasmid#109152PurposepL2 plasmid backbone for assembly of a transcription unit along with constitutive expression of EGFPDepositorInsertsmRFP
EGFP
UseSynthetic BiologyExpressionBacterial and MammalianPromoterCMV and pTetAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free NES (M)
Plasmid#182437PurposeYeast integrative plasmid for expressing ERG20(F96W-N127W) (GAL10 promoter) and AcNES1 (GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS(M)
NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMAT_41BBICD
Plasmid#197097PurposeThis plasmid contains the coding sequence for the intracellular domain of 4-1BB. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for the intracellular domain of 4-1BB.
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCM1.35
Plasmid#17248DepositorInsertGFP:H2B from pKS111-His in pDONR201
UseGatewayAvailable SinceFeb. 26, 2008AvailabilityAcademic Institutions and Nonprofits only -
PB-Antares2
Plasmid#120868PurposePiggybac transposon plasmid for live animal optical imagingDepositorInsertpcDNA3-Antares2
ExpressionMammalianMutationAntares2 ampliconPromoterCAG PromoterAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
rAAV-CAG::FLEX-rev:ChR2HA:2a:PSAML141F,Y115F:GlyR
Plasmid#32483PurposeCre-dependent expression of ChR2 and PSAM-GlyR (L141F,Y115F) neuronal inhibitor, with IRES-EGFP markerDepositorInsertChR2HA-2a-PSAML141F,Y115F:GlyR
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsChR2 2APromoterCAGAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP973-1
Plasmid#99496PurposeTEV::linker::meGFP:3XFlagDepositorInsertTEV::linker::meGFP::3XFlag
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only