We narrowed to 14,243 results for: crispr grnas
-
Plasmid#240865PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-Seq1
Plasmid#240094PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
px330 Gatad2a sgRNA (for deletion)
Plasmid#110814PurposeExpressed sgRNA for generating Gatad2a deletion (knockout ) in mouse cell linesDepositorInsertmGataD2a (Gatad2a Mouse)
ExpressionMammalianAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pegRNA entry vector - pUC19-U6-[BsmBI_entry]-term (MNW320)
Plasmid#208977PurposeEntry vector for human U6 promoter driven SpCas9-based pegRNAs, comprised of hU6-[BsmBI]-terminator (spacer and RTT/PBS oligos must be cloned in)DepositorInsertpUC19-U6-[BsmBI]-term (pegRNA_entry_vector)
UseCRISPRTagsBPNLSExpressionMammalianPromoterhuman U6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO Luc Firefly 2xgRNA - spCas9 iRFP670 puro
Plasmid#166134PurposeThis plasmid allows efficient KO of the firefly luciferase gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting firefly luciferase gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgRNA targeting human SLC12A5 gene stop codon
Plasmid#158577PurposeFor generate double-strand DNA break near the stop codon of the human SLC12A5 gene that encodes neuronal chloride transporter KCC2 protein.DepositorInsertsgRNA targeting human SLC12A5 gene stop codon
UseCRISPRTagsCas9 and GFPExpressionMammalianAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRi-D2
Plasmid#182927Purposeinducible CRISPRi plasmid with gRNA targeting to psbD gene in Synechocystis 6803DepositorInsertddcpf1
UseCRISPRAvailable SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPRmTmG2
Plasmid#69992PurposeThe CRISPR construct targets near the LoxP sites in Rosa-pCA-loxP-mTdtomato-loxP-mEGFP mice.DepositorInsertgRNA that targets near LoxP sites
Available SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo
Plasmid#183411PurposepiggyBAC-based sgRNA entry (Esp3I) and Tet-On 3G transactivator expression vector. Insert protospacer and transfect with CRISPRa (183409) or CRISPRi (183410) plasmid for inducible epigenome editing.DepositorInsertTet-on 3G
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterEF1AAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCM100_ PB5'IR-hU6-gRNA-CS1- CAG-tdTomato- PB3'IR
Plasmid#229995PurposePiggyBac sgRNA cloning plasmid with tdTomato reporter with a capture sequence (cs1)DepositorTypeEmpty backboneUseCRISPRTagsNotI site for NEBuilder HiFi DNA Assembly with ss…ExpressionMammalianPromoterCAGAvailable SinceFeb. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-inteinC-Sauri C aa439-1061-U6-Camk2d sgRNA7
Plasmid#220129PurposeExpresses Sauri cas9C by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, inteinC, nSauri Cas9C
UseAAV and CRISPRExpressionMammalianPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR Human CASP9 -2
Plasmid#198420PurposeExpresses Human CASP9 Specific gRNA/Cas9 Complex and Reporter ProteinDepositorInsertHuman CASP9 Specific gRNA (CASP9 Human)
UseCRISPRTagsCas9/Orange Fluorescent Protein ReporterExpressionMammalianPromoterU6; CMVAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR Human CASP9 -1
Plasmid#198419PurposeExpresses Human CASP9 Specific gRNA/Cas9 Complex and Reporter ProteinDepositorInsertHuman CASP9 Specific gRNA (CASP9 Human)
UseCRISPRTagsCas9/Orange Fluorescent Protein ReporterExpressionMammalianPromoterU6; CMVAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
BRD4 CRISPRi plasmid
Plasmid#154890PurposeHuman BRD4 CRISPRi gRNADepositorInsertBRD4-targeting gRNA
UseCRISPR and LentiviralAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-Non-target sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196989PurposeDerived from pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP with non-target sgRNADepositorInsertNon-Target
UseCRISPR and LentiviralAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
(pRZ318) AAV: U6-gRNA(FLEX)-EF1a-mScarlet
Plasmid#254587PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and mScarlet from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ320) AAV: U6-gRNA(FLEX)-EF1a-ZsGreen
Plasmid#254588PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and ZsGreen from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ76) AAV: U6-gRNA(cs1)-EF1a-mCherry
Plasmid#254583PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and capture sequence in scaffold and mCherry from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBR322-sgRNA-pvc18-20
Plasmid#243747PurposePVC cargo/regulatory region - deleted toxin cargos (Pdp1/Pnf) - vegfa sgRNADepositorInsertvegfa sgRNA-pvc18-20
ExpressionBacterialAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only