We narrowed to 3,550 results for: lenti crispr cas9 plasmids
-
Plasmid#192686PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a, U6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_3
Plasmid#192687PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a, U6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Blast
Plasmid#83480PurposeMammalian expression of Cas9 and sgRNA scaffoldDepositorInsertBlasticidin S deaminase
UseCRISPR and LentiviralTagsExpressionMammalianMutationReplaced puromycin N-acetyltransferase on the ori…PromoterEF-1αAvailable sinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A iRFP670 P2A puro
Plasmid#122182PurposeThe plasmid codes for a Flag-spCas9 protein, a iRFP670 fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorInsertsUseLentiviralTagsT2AExpressionMammalianMutationPromoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A mNeonGreen P2A puro
Plasmid#122183PurposeThe plasmid codes for a Flag-spCas9 protein, a mNeonGreen fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorInsertsUseLentiviralTagsT2AExpressionMammalianMutationPromoterAvailable sinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A TagRFP-T P2A puro
Plasmid#122200PurposeThe plasmid codes for a Flag-spCas9 protein, a TagRFP-T fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorInsertsspCas9
TagRFP-T
UseLentiviralTagsT2AExpressionMammalianMutationPromoterAvailable sinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
lenti SYN-dCas9-KRAB-MeCP2
Plasmid#155365PurposeExpresses dCas9-KRAB-MeCP2 fusion driven by human SYN promoterDepositorInsertdCas9-KRAB-MeCP2
UseCRISPR and LentiviralTags3x FLAG and 7x HisExpressionMammalianMutationPromoterSYNAvailable sinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide1
Plasmid#118158PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA1 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterEF1a core and U6Available sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR BFP-guide1
Plasmid#118157PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA1 against the BFP CDSDepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterEF1a core and U6Available sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide2
Plasmid#118159PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA2 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterEF1a core and U6Available sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide3
Plasmid#118160PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA3 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterEF1a core and U6Available sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-Lambda2
Plasmid#104184PurposeLentiviral transfer vector that carries U6-driven non-targeting sgRNA using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-sgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dCas9-KRAB-gRNA-TRE-blast
Plasmid#201152PurposeLentiviral expression of S. pyogenes dead Cas9 (dCas9/dSpCas9/SpdCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsdCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: TACGTTCTCTATCACTGATPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti GFAABC1D-dCas9-KRAB-MeCP2
Plasmid#194701PurposeExpresses dCas9-KRAB-MeCP2 in AstrocytesDepositorInsertGFAABC1D promoter
UseCRISPR and LentiviralTags3xFLAGExpressionMammalianMutationNonePromoterGFAABC1DAvailable sinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti SYN-SVI-DIO-dCas9-VPR
Plasmid#164576PurposeExpresses a SYN-driven, intron-containing dCas9-VPR fusion in which the part of the dCas9 cassette is double floxed and in inverted orientation (DIO). Requires Cre-dependent recombination.DepositorInsertA DIO FLAG-dCas9-VPR cassette containing an SV40 intron
UseCRISPR, Cre/Lox, and LentiviralTagsFLAGExpressionMammalianMutationPromoterAvailable sinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EFS-Cas9-P2A-HygR
Plasmid#164134PurposeLentiviral construct for the expression of SpCas9 driven by EFS promoter in mammalian cellsDepositorInsertSpCas9 (cas9 Synthetic)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFSAvailable sinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_PGK-Cas9-P2A-HygR
Plasmid#164135PurposeLentiviral construct for the expression of SpCas9 driven by PGK promoter in mammalian cellsDepositorInsertSpCas9 (cas9 Synthetic)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterPGKAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CMV-Cas9-P2A-HygR
Plasmid#164133PurposeLentiviral construct for the expression of SpCas9 driven by CMV promoter in mammalian cellsDepositorInsertSpCas9 (cas9 Synthetic)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-dCas9-KRAB-blast
Plasmid#89567PurposePlasmid expression dCas9 protein in fusion with KRAB domainDepositorInsertdCas9
UseLentiviralTagsBlasticidin resistance gene and KRABExpressionMutationD10A and H840APromoterAvailable sinceJune 30, 2017AvailabilityAcademic Institutions and Nonprofits only