We narrowed to 169 results for: primer
-
Plasmid#68710PurposeContains the sgRNA backbone sequence (tracrRNA, 82 bp) and is used as DNA template to amplify a specific sgRNA using a forward primer with the protospacer sequence for gene targeting.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable sinceSept. 14, 2015AvailabilityIndustry, Academic Institutions, and NonprofitsCited by
-
pGZ110 (pFA6a-3FLAG-MNase-TRP1)
Plasmid#70233PurposeChEC-tagging vector encoding a 3xFLAG tag and aa 83-231 of Mnase in pFA6a-3HA-Trp1 replacing the 3xHA tag. These vectors retain compatibility with the F2/R1 primer pairs commonly used for epitope tagDepositorInsert3xFLAG tag and aa 83-231 of Mnase
UseYeast genomic targetingAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSL3927 (pDonor(plasmid)_Pse)
Plasmid#200905PurposeEncodes a mini-transposon derived from Pseudoalteromonas Tn7016,with a CmrR cargo, as well as a primer binding site for deep sequencing purposes at pTarget. Total transposon size = 1,087 bp.DepositorInsertMini Tn7016 (pTarget NGS)
ExpressionMammalianAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pc5139-pEGFP-H3.1-K36M
Plasmid#241430PurposeExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATCDepositorInserthuman Histone H3.1 (H3C1 Human)
TagsEGFPExpressionMammalianMutationlysine at position 36 to methionine (K36M)PromoterCMVAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-TO-DsRed
Plasmid#16340DepositorInsertDsRed
ExpressionMammalianMutation5'Prime Site: Not I 3'Primer Site : No…Available sinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-TO-DsRed
Plasmid#16340DepositorInsertDsRed
ExpressionMammalianMutation5'Prime Site: Not I 3'Primer Site : No…Available sinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pc2099-pEGFP-H3.1
Plasmid#241429PurposeExpresses human Histone H3.1 as fusion to GFP constructed by PCR using Primers: h3.1-cl-fw (AAGAATTCAATGGCTCGTACGAAGCAAAC) and h3.1-cl-rv (AAGCGGCCGCTGCCCTTTCCCCACGGATG) cloned into pEGFP-C1DepositorAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-3P5P
Plasmid#219680PurposeCROPseq vector enabling gRNA detection via mRNA-based capture (CROPseq), 3'-based direct capture using 10x capture sequence 1 or 5'-based enrichment using a custom reverse transcription primerDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsEF1a-Puro-P2A-mCherry2-WPRE-hU6-gRNAExpressionMammalianAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
eScaf
Bacterial strain#220921PurposecssDNA production strainDepositorBacterial resistanceNoneSpeciesEscherichia coliAvailable sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
BL21 ΔrecBCD
Bacterial strain#176581PurposeE. coli BL21 strain (with recBCD genomic locus deleted) for making cell-free extracts for Linear DNA expression.DepositorBacterial resistanceNoneAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
BL21 Rosetta2 ΔrecBCD
Bacterial strain#176583PurposeE. coli BL21 strain (with recBCD genomic locus deleted) for making cell-free extracts for Linear DNA expression. Contains pRARE2 plasmid.DepositorBacterial resistanceChloramphenicolAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
DHL708
Bacterial strain#98417PurposeBacterial Strain with Genotype: MC4100 ∆clpPXDepositorBacterial resistanceStreptomycinAvailable sinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Syn61
Bacterial strain#174513PurposeRecoded E. coli strain without TCG, TCA, or TAG codons in all open reading frames. Full sequence - GenBank: CP040347.1DepositorBacterial resistanceStreptomycinAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
YM138
Bacterial strain#61953PurposeC43(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. cysE gene deleted.DepositorBacterial resistanceNoneAvailable sinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
RF11
Bacterial strain#61961PurposeC43(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. metA gene deletedDepositorBacterial resistanceNoneAvailable sinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
ML14
Bacterial strain#61911PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. tyrA gene deleted.DepositorBacterial resistanceNoneAvailable sinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
BL21(DE3) ΔserC
Bacterial strain#197656PurposeDerivative of BL21(DE3) with the serC gene knocked out. This strain is used for expressing proteins containing site-specific non-hydrolyzable phosphoserine.DepositorBacterial resistanceNoneAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
RF1
Bacterial strain#61962PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. glyA gene deletedDepositorBacterial resistanceNoneAvailable sinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
RF10
Bacterial strain#62076PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. lysA genes deleted.DepositorBacterial resistanceNoneAvailable sinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
RF12
Bacterial strain#62077PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. trpA trpB genes deleted.DepositorBacterial resistanceNoneAvailable sinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by