We narrowed to 14,352 results for: Cas9
-
Plasmid#86985PurposeFor cloning and expression of sgRNA together with Venus expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertVenus
ExpressionMammalianMutationVenus GFP variantPromoterCAGAvailable sinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCB-CBEv2
Plasmid#221139PurposeCoxiella burnetii CRISPR-Cas9 cytosine base editing plasmid version 2 without sgRNA construct. Expresses 3xF-BE4-PpAPOBEC1(H122A).DepositorInsert3xF-PpAPOBEC1(H122A)-Cas9n-UGI-UGI (BE4-PpAPOBEC1(H122A))
UseCRISPRTags3xFLAGExpressionBacterialPromoterlacIq-PtacAvailable sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
EC64434
Plasmid#209518PurposeCloning in complete guide expression cassettes, with Cas9 & Cas12a(D156R)DepositorTypeEmpty backboneUseCRISPRAvailable sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa-VPR mini.-1X snRP1
Plasmid#99687PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with 17 nt snRP1 poly adenylation signalDepositorPublicationInsertdCas9
UseAAVTagsVPR miniMutationdead Cas9Available sinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
DHFR-PP7-VP64_T2A_GFP
Plasmid#86167PurposeExpresses PP7-VP64 fused to DHFR domain on N-terminus in mammalian cellsDepositorInsertDHFR-PP7-VP64_T2A_GFP
UseCRISPR and LentiviralTagsDestabilized domain (N-terminus version) of E.col…ExpressionMammalianPromoterEF1aAvailable sinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSH624-ssr
Plasmid#199241PurposeExpresses the gene codying for the Ssr recombinase from Pseudomonas putida DOT-T1EDepositorInsertsingle-stranded DNA recombineering
ExpressionBacterialPromoterlacIq-PtrcAvailable sinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
modRNAc0-ABE8e-P2A-GFP
Plasmid#178177PurposeIVT template plasmid for making ABE8e-P2A-GFP modRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertABE8e
UseIvt template plasmidTagsP2A-GFPPromoterT7 promoterAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSF280
Plasmid#167675PurposeIntermediate vector for six gRNAs using GoldenGate, contains ccdB and attL1-L2 sites for GatewayDepositorInsertattL1-ccdB-attL2
UseCRISPRAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMH4
Plasmid#52529Purposeserves as PCR-template to generate HR donors for C-terminal 2xFLAG-tagDepositorPublicationInsert2x FLAG-tag
UseBlunt cloning kitAvailable sinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
BCJJ163
Plasmid#117512PurposeAtRPS5a promoter Golden Gate Level 0DepositorInsertBsaI:GGAG:pRPS5a:AATG:BsaI
ExpressionPlantPromoterAtRPS5aAvailable sinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDD378
Plasmid#91827PurposeCodon-optimized HaloTag donor for the SapTrap cloning systemDepositorInsertHaloTag-C1
UseCRISPRExpressionWormAvailable sinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-module1
Plasmid#222838PurposeSubcloning for Golden Gate assembly of CRISPR/Cas9 vectors (module 1)DepositorTypeEmpty backboneUseCRISPRAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-module2
Plasmid#222839PurposeSubcloning for Golden Gate assembly of CRISPR/Cas9 vectors (module 2)DepositorTypeEmpty backboneUseCRISPRAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-module3
Plasmid#222840PurposeSubcloning for Golden Gate assembly of CRISPR/Cas9 vectors (module 3)DepositorTypeEmpty backboneUseCRISPRAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-module4
Plasmid#222841PurposeSubcloning for Golden Gate assembly of CRISPR/Cas9 vectors (module 4)DepositorTypeEmpty backboneUseCRISPRAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-module5
Plasmid#222842PurposeSubcloning for Golden Gate assembly of CRISPR/Cas9 vectors (module 5)DepositorTypeEmpty backboneUseCRISPRAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-module6
Plasmid#222843PurposeSubcloning for Golden Gate assembly of CRISPR/Cas9 vectors (module 6)DepositorTypeEmpty backboneUseCRISPRAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
Plasmid#68356Purpose-The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only